Oryctolagus_cuniculus Locus KIF5B
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus KIF5B
Oryctolagus_cuniculus
KIF5B
GeneScaffold_5368
SNORA9
2672..2804
74356
TAATTCTAGCTCCTTGTACTTCAAACTTAACTTGCTTTGGTTTCTTGAATGCTCGGAGT
TCTTTTCTGCCTTGGGAACTTCAAGCTGCTTATTTCTAATGCCTGGACTGCTTTCCCTCA
TACATTCCCCCTTCCTCGTGACTAATATTGAAGAGTGACAGAGAGCTAGGTGCTGTTTAC
TCAGTTTTAAAATATTCCTTAAATATCCCTTCTCCAAGGGTTTTCCTGATACTTTTCTGC
TCTCCCCTAGACTCAGTGCCTCTCATGTACTCACACTCATTTGCATGAGTCAGTTCTAGT
CATCTAATTGTCTAATTTTTACCCTGTTTTTACTTAGCTTCACAAAAGTAGATAGTGAAT
TTGTCATTCTAGAATGACATCTTGTGTTCTGTAATATTTATTAAATCGAAGAATGAAAAC
TTCTCAAAATCAACTGAAAAGCTCAATGAAATAGCAAAAGGAAGCCTGAATTATAATTTA
ATTTTATCATTAACAACTTTTTTTTTCAGGATGCTAGTTTCTTTACTGCTAAAATGATGT
TAGTATTGAAAAATCTGAGGGAACTTTATGGAAAATGGAATTAAATGACAAAGTTTTTTG
GCAAGGAAATTTTGAAGTTCTTGCATAGTGTTTTCACAATACATAGTTTTCATGAACATT
TGAAGACACCTTGTAGAGTCTCAACACCTAACAAACTGGGCAGTCATTTAAAAAAGAATG
CATTCAGCCTTACTTGAGTGGCTACCACATTGTAGTTTACTACAGTAGGCCCTGGGAATA
TATCAAAGAATAAAATAGACATTCTTGTGAAATTTATCCTGCTGGATTTGTACATGGTGA
CCTCAAAAGTTACTTGCACTCAAAAGATTCAGTGATACGAAGTGATGATACTGGCTATAC
ATTTTTGAAGATTAAATATCAGATAGAATATTTAAGGGAGCTTAGAAATACCTACTCACC
TTTAATTATATGACTGAAACGCTTTGTCTTTTGTTTTGCAGTCCAAGCCTTATGCATTTG
ATCGGGTGTTCCAGTCAAGCACATCTCAAGAGCAAGTATATAACGACTGTGCAAAGAAGA
TTGTTAAAGGTAAATATACTTAACCTGTTGTCTCAGTAGTAAGTAACATTTTGTTTGTGA
TGCTTTCCTACTCAGTAGTCACCTTTTTGTTTTCGTGGCCCTTTCGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGCCGGAGCTGTGTTGATCTGGAGCCAGG
AGTCTCTTCTGGGTCTCCCATGTGGGTGCAGGGGCTCAAGCACTTGGGCTATCTTCTACT
GCTTTCCCAGGTCATAGCAGAGAGTTGGATCAGAAGTGGAGCAGACAGGACTCGAACCGG
CACCCATATGGGATGCCAGCACTGCAAGCGGTGGCTTTACCTGCTACGCCACCGTGCTGG
TCCCCTTACTGTGATTTTTTAAATTTTGTATTTCCTAAAACCATAGAACTCCAGAGCTGG
ACAGGGCATAGTTAATATAAAAATTTCTTTTATCAGAGGGATCTTAACATTTAAATAACT
AACTACTTATGATTTATCACATTTTTTGACAGCTCTAGATGTTTAAACATGCTTTTTAGA
TTGAGGCAAAATCTGTCTTGTGGCATTTAGTAGTTAGAGGAGTTGGAATTTAATATAAAA
GTATGACTTTGGATTAGGAGGAGCACATCCCAGTAACAGGAGAGTAAATAGAGTTTATGT
GTTGCTTTATAGTTGTGATGGAGGGAAAATGTAGATGTTCTCTCCATGTTAGTTACTTAC
TGTCTGCATATAGGAAGCATAGGCGTGACTGAGAGTGGGGGTGTGAAGAATTAGGAAAAG
AGTTGAAATGCTGGATTAGGGTAGTGGAGCAGTGTTACCAGGTAGCACCGAGGGCCCTCT
TGAGGTTAGCTGTCAGAAGGATTGAATTTCTCCGTTTGGAGTCTTGCCAGGTAAGTACAA
AAGAAAGAAGGGAAAAAGAATTAAGGATACACCAGCAAGCCTCCAGCATGCTTGGGTCTG
CTGTGACCCTGTGCATTCCTGCAGTGCTTGCCAGAACAGTTTTGAAACGGTTTGAGGCCT
TGCCCTGCTCCATCCAGTGTAAGGTTATAGAACTTTCGGACAATTGGGGGGGAAAAAGGA
AGAATTAGGGTTCTAGAAGGAGTTAGGATATGAAGGAGTAATAGAAGGTAACTGTGTGTG
TGTGTGTATTTGTATAATATTTATTTGTTACAGAGGTTTTTTTTTTAAAAAGATTTATTT
ATTTATTTGAAAATCAAAGTTAAAGAAAGGGAAAGACAGAGATCTTCTGTCTTCTGATTC
ACTCCCCAGATGGCCACAACAGACAGGGCTAGGCCAGGCCAAAGCCAGGAGCCAGGAATT
TCATCCAGGTCTGACACATGGGTGACAGGGGCTGAAGTTAGGCCTCTTCTGTTGCTTTTT
CCAGGCCATTAGCAAGGAACTGGATTGGAAATAGAGAAGCCAGGACACGAACCAGCACCC
ATGTGGGATGATGGCATCAAAAACAGCAGCTTAACCACCTGTGCCACAGTGCCAGCCCTC
ACAGACAGATCTTCTATCTGTTGGTTCAGTGATTAGCCAAACAGGAAATGAGGCCATACT
TTTTGCTTATGAAATTTTGTTCTACTTGTCTGTAGTTCCCATAATCTATAAATTTTTCTC
CTTTTGAAAATGAGTGGGTCATTTGCAAATTATTCATCTTTTGTTTGCCTAATTCTGTTT
GTCTTTTTTGTTTTTTTTTGTTGTTGTTGTTTTCAAGATTTATTTGAAAGAGTTACACAG
AGAGAAGGAAAGGCAGAGAGAGAGAGGTCTTCCATCCGATGGTTCACTCTCTAGTGGGCC
GAATGGCTGGAGTTGCCCCATTTGAAGCCAGGAGCTCCCTCCAGGTCTCCCACATGGATG
CAGGGGCCCAAGGACTTGGGCCATCTTCTACTGTTTTCCCAGGCCATTGAGGAGAGCTGG
ATCAGAAGTGGAGCAGCTGGGTCTCGAACAGGCGCCCATATGGGATGCCAGCACTTCAGG
CCAGGATGTTAACCCACTGCGCCACAGCGCCGGCCCCCATTTTGTTTGTTTTTTAACACT
TACCTGTGAAAGTTTTCATTCCAAGAATGTAATTTTTTTGTTTTTTAAAGATTTTTTGTT
TGTTTGTTTGAAATTCAGAGTTACAGAGAGGGAGAGAGGGAGGGAAAAACAGAGATCTTC
CGTCCGCTGGTTCACTCCCCAAAATGAATGCAATGACCAGGAGCTGGGCCAGGGCCAAAG
CCAGGAGCAAGGGAGGTTCTTGTTGGTCTCCCACGTGTATGCAGGGGACCAAGCACTTGG
GCCATTTTCCACTGCTCTCTGAGGCATATTATCAGGGAGCTGGATAGGAAATGGAGCAGC
TGGGACTCAAACTGTCACCCACGTGGAATGCTGGCATTGTAGGCGGTGACTTAACCTGCT
GCACCACAACACCACACCCTATTCTAGTGATTTTTATCTCTCTTTCATATATCCTCCGTT
ACATAGTCTGTATTGCAGGTTCATACCTACCTTTCTTACTCTTTGAGATAATCATTACCC
TGGTGTCTTGGGTCCATGTATCCTACTACTTCTGGTTTTATTACTGTTTATAATTCTAAG
ATGACATCATTTGTTGAATTTAGTTTCCCCTTCCTTTTCTCAAAATTTCAGCCCTTCATT
GACATGTTCCTACTTTACTGTCTGGAACCAAATTCAGGATAATAATTCCTTTCTTTTAAG
TATAGTTAAGGCATTGGAATGAGGCAGATCTAGAGTGAAGTCTAGGCTCTGTTTGACTTT
CGGCAAGTTACTTGGCCTTTCTAAGTTTCTAACTCTGCAAAATAGGAGGTAACCTGAGGA
TTTAAGCACACAGTAGATGCTGGCTACTCATTGTTTCATCTTCTGGGAGAGCAACCATTC
TTTAATTCAATCAACTGATGTATGCTTGGGATAAGGTCAGTCTAAGATGGTTTTCACTGT
ACAAAATTAAATTTCCAGCAAGTGTTAAAATGGGAGGTTTCTGTCGATTGTCTTTTTCCT
CTTCTGTGCCAGCTCTGTAGTTTATATCAGGACAGTAGCACCCGACGTGCCTTTTCCCTC
CTGTCTTCACCCAGATGCTCTCTGCCGATGTAGTGGTCTCATGACAGAGTTGCCTCTGTG
TCCGCCTAGTTCACACCCCTATTTTGCAGTAGCTAATACGAAACCAGGAGATTGGAACTC
CATCTGGGTTTCCTGCATGGGTGGCAGAGACCCTGTACTGAACCATCATTTGTTGCCTCC
CAGGGTATGCATTGGAAGCTGGATTGGAAGTGTGGTAGCTGGGATGTGAACTAGGCACTC
AGAAAAGGGGTGTGGGTGTCCCAAGCAGTGACTTAAGTCGTTGCCCCAAAATGGCTGTTC
CTCAAAATTTTTTTGCACCAAAATAAACTTATCTTCTGAGTCTGTTCTACTAACTTTTTG
AAGTATCCTTGTATAGTAAGTTCACTGGTTAAGAGCGTATCTCTGGCACCAAGACTTTTC
GGTTTGTATCGCAGTTCCATCTTACTAGCTGTGAAACTGTAGACCAGTTATTTAACCTCT
CTGTGCCTCAGCTTCCTCATCTGTAAAATGGGACTCCTTGTAGAACCTTGCATTAGGAAT
AGGAACAATACTTGGAAGCTGCGCTATCCCTACCCCACCATCCCCCCTTATATTTGAAAG
GCACAGGGACTGAGACAGACCATTTGCTGGTTCAGTGCCCGAATGCTTGCATTAGCCAGA
AGCCTGGTACTTTGAAAGATCTCAAACAATATTATGTGTCAACTTTTTTTTTTTTTTTTT
TTTTATCTGTTTGTAAGGTAGAGTTAACAGAGAGGCAGAGGCAGAGAGAGAAAGGTCTTC
CATCTACTGGTTCACTGCCTAAATGGCCACATCGGCCAGAGCTGGGCTGATCTGAAGCCA
GGAGCATCTTCCAGATCTCCCACCCAGGTGCAGGGGCCAAGCACTTGGGTCATCTTCCAT
TGCTTTCCCAGGCCATAGCAGAGACCTGGATTGGAAATGGAGGAGCCAAGTCTCGAACGA
GTGCCCAAATGGGATGCAGGCACCGGGAGCAGAGGCTTAGCCCACAACGCCTGCCCCTGT
CTGTAAAGTTTATTCATAGTTGTCCACTATCTGTCTCTCAAAAGAAAGACCAAAGTATAT
TTTAAAAGGGGAAGGAGGCCTTAGAAAGATGCTGTGTTAGTGATGGTAATGATCATTTCA
TAAGCATTTGAGTCCTGCTGGTACCAGGCACTGTACTAGCAGCCCTGACCTCCAGGAGTT
CACAGGCTGGTGGCGAAGGCAGACTGGTAAATGCACCGTTACAGTACTTGGTACTAAGTA
TTGAGTGCAGGCAACCTACAGAGCGAGACTTCCACCCAGGTTTGTCTGGGTTAAAGGAAG
CGGCGAAGCCTGAGCTGGTCTTGAAGGATGCACAGAGTAGGACCTGACCACTTCCCCAGC
CAAGAGCAACCATGTGAGGAGGATACTCACTGAAGACAATGCATTTCATTATACAGATTT
TACTTCAGGAAAATGTAATATTAACTAATATTATGGGTAAGTGTTTAGGTGGAAGTATAC
TGAAGTGTATTGATGTCTGCAGTTTACTTTGAAATGGCATTTTAAAAGATAAATGCATAC
AGGGGTGGATAGATGATTAAAACAAACAATGAAATGCTAGTGGTAGACTCTTAGTGTTTA
TGGGAGTGATCATTGTAAAATGCATTGTTTTTCTGTACATTAAAGTTTTTTATAATACAA
GGATAAAATCATTATAGAAAACAATTTGGAGATGGGGGAAAGTGATTCTGAGCGTTCTGC
ACCCATGAATTCGATTGATTGTACACTGAAAATACTAAGAAAATATTTAGTTCTATACTG
CAGAGGTAGTTTTTTTTTGTTTTTTTGTTTTTTTTTTAATTTGATTTCTTTGGCATTTTT
TCTTAATATTATCCATGGAATGCAATAAAACAAAGGCCACAGACATTCAAAAATTAATGG
TTGCTTCTGGGAAAAGGAAGTAATTTCAAGCCAGGTGTTTTTTTTTTTTTTTCCCCTCCT
TTTCATTATTCCCTACACAATACAGTATAGTAGCTGTTTACATAATATTTACATTGTGTT
CAGTACTATAAATACTCTAGAGATTAAAGGTATGTGAGAGATTGGGTCTAGACTATCAAA
TACTGTACCCTCTTCTATAAGGGACCAGTATATCCAAGGAATTTATCCTGAAGGTTTCTA
AAACCAGTCCCTTTAGGATACTACAGGATGTCTGTATGTTCCTAATGGATAAAAATGTTG
AAACCGCACTGATGGGTGGTTTACCTAGAAATCAGCTTAATAGTTGTATTTCCTGTACCC
AGAACGGAGCCTAGGTCTTAGTGGATGCTCAGTAAACATTTCCTTGTTGAATATTCCAAA
ATCTCTGTAAATATCAGACTTCTAAAGTTAGGCTTCAGGTGTCACATGGGAGCCTTTGTA
TACAATATAATTTCACATAGCACAAATAGCGCTTTGAGACCTTTCAGCAAATATTTATTT
AGTGGACCTATTGCAGTAGCAGGATGATTGGGTCTTAATGTGAATAAACCTTTTAAAAAT
CTAACAAAAATTTTAATTTTATGCTTAGACTTTATGATTGACTTAATCATTTTAAAGATT
TATTTATTGATTTATTTGAGAGGCAGAGTTACAGAGAGGTCTTCCATCATCTGGTTCACT
CCCTAAATGGCCACAACAGCCAGAGCTGCACCGGCACCCATATGGGATGCTGGTGCTTCA
GGCCAGAGCGTTAGCCCGCTGCGCCACAGCGCCGGCTCCCCTCCCCCTCACTGTTTTCAC
CTGCTGTTTCCAGTGGAGTTTCTCTGGCTTCTTCTAGAAAATACTGCATTTGCATATTTT
GTTTTTTGTCACCTAAAACTAAAAAAAAAGATTCCCCCAAACTGGAAACCAAAAGGTTAC
CCTGTTTGCTCACTGTCTTTTTCTTTTTAAGCATCTTTTAAAAAATTGGGGCACAACAAG
GGCCAGAAGAGGTATTGTTTTAGTTTTGTAGGAACTATCTGATTGATTTTGAGGTAAGAC
TAAGCATTTTACACTTTTTGTAGGTGGAATAAGGATGAAAGTGGTGTGGGTTTGTGAGGT
TTAACCTCCCATTAACAAGTCTTATTTCTAAAAACCAATTCATATCTGTATGTTAAATTG
GCAGAAGCTATTTTTCTTTTATGTGACATACAGCTTTGAAATATGGATGTAATGACATTT
GAGATGTAGACAGAGAGGAGATTATTAATTATAACCTTGAAATTTAATTTGTTTCTAACT
TGACCCAACCCAATTTAATTTGTTTGTAATTTGAGCCCAACAGAAAGTAATTGCTTAGAT
GGGTCATCACTAAAAATTAGTGTTAAGAATGCATTATTGTTCGGCGCCGCGGCTCACTAG
GCTAATCCTCCGCCTTGCAGCGCCGGCACACCAGGTTCTAGTCCTGGTCAGGGCGACGGA
TTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTATGGCCGGGAGTGCAATGGA
AGATGGTTCAAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCC
TGCCATCAGATCAGCGCGGTGCACTGGCCGCAGCGCGCCGGCCGCAGCAGCCATTGGAGG
GTGAACCAGCGGCAAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTG
CCTGTCTTAAAAAAAAAAAAAAAAATACATTATTGGCCAGCGCTGCGGCTCACTAGGCTA
ATCCTCCGCCTATGGCACCGGTACCCTGGGTTCTAGTCCCGGATTGGGTGCCGGTTCTGT
CCTGGTTGCTCCTCTTCCAGTCCAGCTCTCTGCTGTGGCCCGGGAAGGCAGTGGAGGATG
GCCCAAGTGCTTGGGCCCCTGTACCCACATGGGAGACCAGGAGGAGGCACCTGACTCCTG
GCTTAAGATCGGCGCAGCGCCGGCCGTGGCGGCCATTTGGGGGGGTGAACCAACGGAAAA
AGGAAGACCTTTCTCTCTGTCTCTCTCACTGTCTAACTCTGCCTGTGAAGATAAATAAAT
AAAAAGAACACATTATTTATTTCCTGTAATGTCTTCATGAATCCTTTACATACTAAACTC
GATGAACTCTTTCATGTTAGTGTAAAGAAAATGTGAATCTATTACCATTCTGCCCACAAA
TATTGTATTATGCAGAATTAAGTGTGCATGGATGAGGAACAGGGTTGTGTGTGTGTGAGG
GCTTTGAGATTTTTTTAAGTAACTCAGGATAATTGTGACATTTACCTATAAAATTCTTAA
GTTATTTCTTGGGAAATTTTTACTTAAGAATTAAATTCCCTAAAGTATAAAAATCTCTGT
CTCATAGATGTACTTGAGGGATACAATGGAACAATATTTGCATATGGACAAACATCATCT
GGGAAGACACACACAATGGAGGTAACATTTTATAATCTGTACTTGGATGTACTGGCATAT
TTTGTTTTTTAAAGATTTATTTATTTGAAAGCAGAATAACAGAGGGTAACAAGGGGCAAC
AGAGAGAGAGAGAGAAATCTTCTGTACACTGGGTCACTCCCCAAATGTCTGCCACAGCCA
GAGCTGGGCCATGCCAAAGCCAGGAGCTTGGAACTCCATCCAGGTCTCCCAGCTGGGTGG
CTGGGGCCCAAATACTTGGCCATCTTCTGCTTTGCCAGGTACGTTAGCCAAGGGCTGGAC
CTGAAGCAGAGAGCCAGGACTTGAACCGGCACTCATATAGGATTCCAGCATTGCACAAGT
GCCAGGATACTACCTCCTGCATATAGTTTTACCGGCACATGTTGATTTGTTATTCTTGCA
ATTATTTTACTATGCTTGGCATTTTTGTTTGCTATTTATTGCTTTTTTTCATACAAGTAA
TCTACATGATAACATCATTATTGGAATCTAATTCTTGAGTTTGAATAGTAAGGGATGCCT
ATATTGGAGAACATATATTGGTTTGTCTTGTTGTTTAACGTAACCACAAAATATGAACAT
TTTGGAATTAAATAGGAATGTTATATCACCCTCTAAATATGGAAAAATTTGGGTGTCTAT
TGTTGATTTTATTCAGAGTGGTTACTTTTGCTCTTCTCCTTGGCTTCTCTCCCCTGAATA
CCTGCCACACTTCGCTGAGAACATCACCACAGTTGTCAGTGGTGGTATTAATAATAATAG
ATGGGACCTGCTCTTACTTTGGCTTCTAGAAAACAGCCTGTGACCTTCTGCCACCGCTGC
AGAACATCTGCTTTTATCATTGATCTGAGAGTAGTTTTTGCTTATTTTAGTGTAGCTCAT
AGTCACAGTCACAGAGAATATGGACATTTCTAGCATTTACATGAATTTTGTTTGAAGTAA
AAGGAACATAGCAAATGTACATAGAAAGAAACAAACTTTTTCAGATATGTTCTTTTTACA
TGCCTGGATAACCCACATCTAGTGATTAAATAATTAATATCACTTGGTCACTCCTGTGGT
GATATATCGAGTATTATGTGTAAAATAGTTGAACTGGATTTTATAGATATTTGTAGAGCT
ATTTTCATGAAAAATAACAATTCCTGTCTTCTATTGATGACTATAAATAGTAGATTGACA
TTTTAAATTTTTACTTCATATTTTAAAATTTGTTTAAACATTTCTAATTTTGTTTTCTAT
TCAGGGTAAACTTCATGATCCAGAAGGCATGGGAATTATTCCAAGAATAGTGCAAGATAT
TTTTAATTATATTTACTCCATGGATGAAAATTTAGAATTTCATATTAAGGTAAATTCCTT
TGGGAGAGGTTGTATTTTATTTTATTCCTAAAATAATTGTTTCAAAAAACAGTAAATGCT
AGGTTTTTTCCTTAGTTTTAAAAATTATTAAAATTTTTTTTATCATCTACGTGAAAAGCA
GAGAGAAGGAGATATTTTCGATCTGCTGGTTCATTCCCCAAACATCCACAACATCGGGGG
CTGGGCCAGAACTCCATCCCAGTCTCCCATGCTAGTGACACGTGCCCAAGCACTTGAATC
GTCATCTGCTGCCGCCTGGAATACATTAGCAGGGAGCCTGCTGGGAAATGGAGCCGCCAG
GACTCAAACTGGCACTCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTTAACTAGTCTGATTCATTTTAGATAAGGGTGTATAGCAGAAA
CTGCTTTTAATTTAGTTATTTTAGCAACTTGGCTAATTTATATCTTCCAGTTTGAATGTG
AGCTGTGGGGAATGTATCGATAACTCTGTCCTCTTAGTCTAGGCAGTACCTGGCATTCAA
ACCTCATAAATATTTAATAAGTGAATAAGGTGTTCAATCATTTTTTCCTTTTTTATTTGT
TTACCCTTTAGGTTTCATATTTTGAAATATATTTGGATAAGATAAGGGACCTATTAGATG
GTAAGTTAAATCCTTGTTCTTTTATTGTTTTAAGTAGTACTTGTTACTAATATTTTTAGT
ACCTTATGTGAAACTGACAAACTATAGGAAATAGATAATTAGATTTTTTAAGTTTTAAGA
TATTGAATACTTTTGACAAAAAGAATAACTTGCTTAAGGCAAGCTACTTCTTAAGTAGTA
ATTACAGCATAGGAAAGGAGCTAGAGAACCTGAGCCCTGCATTTTTGACTTCTACCTTCA
GTTCTTCCATCAGCTGTTAGATACGTTGTTCTTCTTGGGCAAATCTTTGAACCACTCAAG
CTTAATGTTCTTGTTTACAGAATGTAGGTGGCAGAAGGTGAAATGGGCCTAAATTCTGTA
TTGTGCATTGGTTTCTACTTAAGTGTGCTAATATGACAATAAGGTCTTGCTTTAATAGTG
GTGTTTTCATTTTTGTTTTTCCGATTGACCTATTATTGGGCTGCTTGGGGAAGCCTGTCA
ATTCTATTTCATAACTAGTGTTAGATTTTAGAAGAATGTTGCTAAAGTTACTTTTCTTTT
TCAGTTTCAAAGACCAACCTTTCAGTTCATGAAGACAAAAACCGAGTCCCCTATGTAAAG
GTACTTACAAAATAATAGAGAATGTTTAGAAAAGCCTTGTAATAAATTTTAAAGGATATT
GACATATTTTTTGCAAAATTATTTCACAGGGGTGCACAGAGCGTTTTGTATGTAGTCCAG
ATGAAGTTATGGATACTATAGATGAAGGAAAATCCAACAGACATGTAGCAGTTACAAGTA
AGTATTTAACATTTGTTAAGGTACAATAAAATGGCTTTTTATCCTTAAAAGATGTAAGAA
TAACTGGATATCCTATTCAGGTGATTGATTTTAAGACTATGTAAAATAATTCTTTAGGGA
AATTATTAGTAAGAGAAAGTCATGCTTATTTATAGTTTTTCTGTATTTTCATTGCAGATA
TGAATGAACATAGCTCTAGGAGTCACAGTATATTTCTTATTAACGTGAAACAAGAGAACA
CGCAAACAGAACAAAAGCTGAGTGGAAAACTTTATCTGGTTGATTTAGCTGGTAGTGAAA
AGGTATAGTGTTCACATATTCTGACAAGGATATTTAAACATTATATAAACTTACCTTAAA
TTGGGATTTACATGTGATGTTTAAAATTTCCTAATTGGATTTATCTGGGAATTATAATTA
TTGATGTCAAAGCTTTATGATTACGTAAACAAAATTAGCGATTCTTAATTAACTTCTATT
TGGCCATTTTGGCTCAACTGTTACCTTTGAATTAAGATATATGTTTTTAATGAAAACTTG
TTCAGCATATGCTATTATAAATTTTATTACATATTATTATTAAGTAAAGATTTATTAAAT
ATCTCTTTGCTAATATCGGGTATCTCTTTTAAGATTGATTGATTGATTTGAAAGTCAGAA
TTACAGAGAGAGATCTTCCATCCTCTGGTTCATTTCCCAGATGGCCGCAAGTGCTAGGGC
TAGACCAGGCTGAAGCCTGGAGCATCTTTCTGGGTCTCTCATGTGAGTAGCAGGGGCCCC
AGATACTTGGACCATCTTCCGCTGCTTTTCCTAGCCCATTAGCAGGGAGCTGGATTGGAA
ATGCAACAGCTGGGACATGAACCAGCACCAGTATATGATGCTGGCATTGCAGGTGGTGGT
TTTATCTGCTACGCCACAATCTTAGTCCCATATCTCTTTTATCTGTATTGGCAGTGAGCT
CCCTATTGAAACTGGTAACTGTCCATTAGTCCTTTCTGATTTGGTTCTATAGTCATCCCT
CACTGTCAGTAGGGATTGTTTCCAGGATCCCCCTCAGATACCAGAGTCTTGGATGCTCGG
GTACCTTGTATAAAACACTGTGCATAATCTTTGATATAACCTGTGCTTATCTTCTAGTAT
ACTTAAATCATCTCCTAATAAGGTATTCGTAGTTGTTTTACTGTTTAGGGGAAAATGTCT
GTACATGTTCAGTACAGGCACTTCCATTGTTTTCAGATATTTTCTTCTGCACTTGGCTGA
TTCCATGGATATGAAACCCACAGATATGGAGGCCAACTCATTTCTTTTCCTTTGGATGAT
TATCTCATTATCAGTCCTAAAAATATGATTCTAGTCAAGTCAAAATAAGTTGAAATGTTT
TTTAATATTGACCTCTGTGACCATTTTTACTGTTCTGCTAATTTTGTTTCTTCTCAGTTG
AATGGTGATGCCTATTCCCTTCTAGTTAAAAGTTGTACACATATCTCAAAGACTCTTTAA
TCTTGTTATATAATATGTTTAAATTCAGTCTCTTTTTAATAATCACATCATGATGCTTTA
GGAAAACTTAAAAGGTTCCTCTTTTCTAATGTAGGGGACCAACAGATGAATGAGCTAAAA
TTTACTTGTAAATTGGCTATCTTCAAGAGCACAAGCAAAAACAAAATTTGATGTCTCCAA
TCATGTTCTTGTCTGCATCTAGTTGCTTGATTAAGTTCTCAGAAAAGTACTCAAGAAGTG
ACTAGTACCTAGAGTAAATGCCTAGCAAACGTCATGAAACTTTTCACTTTGTTCCTTCTT
TTTTTTGCTGGTTATTGATGACTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGGAAGCTGGAATCAGA
GTGAACCCAGGACTCACGTGTATGCATTCTGACACAAGATGTGGTCATTCCAAGCCATGT
CTTAAGCTCTGTACCAAATGGCTGCCTCCAGTTTTTTATCTGGTGAATTAGTGATACTTT
TTTTTAACCACAGTTATGGGGGCTGACTCAAATTTAGATGGGTTGTGATAAGCACTCTAC
CTTATAGCTTTTAATGTTTATTCTAAGGACAAGATAACAATTGGACAATCTAACTTTCAA
CCATATATGCATGTATTACATACATCAAGACTGATTGTAGTCACATTCTTTTTTTCTTCT
AATTACATCTCTTAGGGCCAAAACAATTAAGAACACAGTTTGCGTCAATGTAGAGTTAAC
TGCAGAACAGTGGAAAAAGAAGTATGAAAAAGAAAAAGAAAAAAATAAGACCCTGCGGAA
TACCATTCAGTGGCTTGAAAATGAACTCAACCGGTGGCGTAATGGTAATAATTTAAGAAT
TTGTCATCTTAGGCTTGTTGGATACAGTCATAGAGCTATTTTATTAATATGAGGTTCTGG
TATGAATATAAATGAAAAAGCATGTCCATTTTCACTTTTTAAGCAATTAAACTCAAAAAT
GAATAAATTCTTTTGTAATTTTGATTTTACTTAAATTAAGCATAGACACATAGAGGCCAA
TTAAGAAGTAACAGCATGACAAGATGGCTGGGTTAGGGTGGAAGCAATAAAATGACAAAA
TATTTTAGCGACTGGATTTCAAAGAATGGCAAAGGAGGGATAAGGGGGGATTAAAGGTAA
TTCCAGCTGTTCAAATTCCAGGCCTTGAACAGGTAGGAAAGTTAGTACAAACTGCTGAAA
CTGGAAAAGAGAGGGAGGGGCAGAGTTAAGAAGATGGAATAGGGCTTTTCCACTGGTATC
CCTTGCATAACCATTGATGTAAGCAGCCATCCATCCATCCATGAACATACCTCCACAAAA
GCTAAGGAATCCCGGTGAGAGCCAGGGTATCTGGTTATACCACAGGAAGAAGACACATTG
AAGTGGTTAGGAAGGACAGTCTTACTTTCCCTGTGTTGTTCCTTCCACAGCCCCAGACGG
CACAGCATTTATGGGAAAGAAAGGGAGTGAGCCTTGGACTCCAGCACTCAGCCTGCCCCA
CAGTAAAGCAGCATCCGGCAAGCTCTGGCTGCCCCTGCTGCCAAGTGGATGTCCACAGAC
ATCTCTCGACTGCCCCAGTGCCGTGTGGGAACCTGCAGCCCAGGTTCAGGCCTGTGAGGT
GGCCTCAGTCTCAAACTTCAACATCCCAGGGCTCGCGACATCCCTCAGTGACAGGCAGGC
CTGGCAACCGCAGACTTCCAGCACCCGGCAGTAGGCAGGGTGTCAGGATCACACGTGACA
GCCTGCCCACTAGTAGCTGCTACTTCAGATACACAGACACTGCCTCTGCTACACAGCCAC
AAGGATCAGGAGCCATAGGAGAGACAGGGCATCACTAAAAGAATAATTAAAGTGCCAGTA
ACCGACAGCTGAAGAAATGAAGATGTATGAACTGCCCAACAAAAAAATCAAATGTTAAAA
GTAAGCTTAGCAAGCTTTAATGGAATGAACAAACATTTCAATAGGAAAACAATGGGATCG
AGATTGAAAAATTCAGTTGAAAAACTGAAATGTAAAAACAAAAATTAGAGCCGACAAATA
CAGTGGATACAATCAAAATAAATGGAATTGAGTGCATCAACAGCAGAATTGATCAAGCAG
AGCAAACTGTGAACTTGAACTTATTCAGAAAAAACACAGGAGGAAAGAGATAAAAAGAAT
AAAACTGAAATTAGTTTTACATGTGTAGATTTCAGTTAACCATCCTGTTGCTTTATTTCA
GGAGAGACAGTGCCTGTAGATGAACAGTTTGACAAAGAGAAAGCCAACTTGGAAGCTTTC
ACAGTGGATAAGGACATTACTATTACCAATGATAAGCCAGCAGCCACAATTGGTGTTACT
GGAAATTTCACTGATGCTGAAAGAAGAAAATGTGAAGAAGAAATTGCTAAATTATACAAA
CAACTTGATGACAAGGTAACTCTTACTTGCTTTCAGTCTCTTATGTTTTAGAAGTGGTGG
GGGAAGTCCAGCCCGTGAGCCTTTAAGGCCTGTGAAATCATTTGGTCCCTGTAACTCTTT
TAGAATAGCAGTGTCATAGGTATTTTTATTTTCCAGTTTTTCTAGTTTCAGTAATATGGG
CGGTTATGATCCATAAACATACTTCTTGATTTGTTTTGATTTTTTTTAACAGCTAATGCA
GTAGCAGAGTATTATAAAAATCACATTCAGTTTCTGTATAGAAACTATATGAGGGCACAT
CTCTTTCAAGCTTAAAGAGCATTCTAAAGAAAGTGTGATATCTGCTCATTGGAGAGCCTT
AATGAAATGGGCTCCTAAAATAAGGGATGTGAAGAGCCTGCTCACAGGTGGTCCAGGGAG
ACAGTAGAGTGGAAGTGCATCCTCCTGCTCTGCTCATATCCATGTCAGTAGTGTGGAAAG
AATACTTTGGGAACCAAGTAAGAGGCAGACATGGACAAGAGCAGTAAATCGGCTGGAAGA
CGATACAGTTACTCTTTTTAACAACTGTGTCTTAAAGTGGCAGGTTTGAAGGGGCTGCAT
AACCATTATTTTCAATAATAGCTTTTAAGCATGGTATTTTTTAGCACATAAAATGTTATA
TGAATGTCTTTGATAGACATAAGCCTTTTTTCCTTGTATAAATGATTGCTAATGGAAAGA
CATTGCCTTTTTTTGTTGTTGTTGTTAGAGATAGGACCTGATACCAATACGATTTTTTTT
TGAATATGCAATGTAAACAGATGTTCAAACAAACCATCTANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGATGCATCCTGTGGCTGGAAGCAAATGTGGACTTTCTC
TTCAGGTTTTGTTTTTGTTTCAAGGTTTGAGTTTTCTCTAACCCAGAGGAGAGCTGGGAA
CCTTTGAAAAATACTCTTTAGTAACATACACCTATTGGACTTTTTAGCTGTCTTCGACTT
TACCTGCTTTGAAGAACAATGCCATTTACCCTCTTACTCTCCTCAGTATTTCTTTCTGAT
CTGCGGGGAGGACTTCCACTAGTGGGCTCGGGGCGGGCGTTTGGCCTAAGTCGCTGGTTA
GGTCACTCATCGGAGTACACCCACATTGGAGTCCTGGGATTCGATAGCTGGCTCCTGCTT
CCCCTTCCACTTCCTACTGATGAGAATCCCGGAGGCAGCAGTGGTGGCTCAAGTAGTTGA
CTTCTGCCGCCCACTTGGGAGACCTGGATTCAGTTCCTGACTCCCAGCTTTACTGCACTT
CCACTGCAGGCATTTCGGGAGTAAACCAGCAGAAGGGAACTCTTGTTTGTCTGTATCTCT
CAAGTAAAAACAGTGGAGCTGGCGCTGTGATGTAGCGGGTAAAGCCACTGCCTGTAGTGC
GGACATCCCATATGTGCACCAGTTCATGTCCCAGCTGCTCCATTTCCAATCCAGCTCCCT
GGTAGTGTGCTTGGGGAAGCAGTGGAAGATGGCCCAAGTCCCTGGGCCCTTGCACCCGTG
TGGGAGACTAGATGAAGCTCTCAGTCCTGGCCATTACAACCATTTGGGAGTGAACCAGTG
GATGAAAGATAACTCTCAATCTCTCTCTTTCTTTAAACTCTGCCTTTCAAATAAATAAAC
CTTCTTTTTTAAAAAAAGAATATAGGAAATGAACAATTAAAAAAAGAAAAACAGTGGACT
GAGTAATGTTAGACTTCATTCCCCAATGAAAAGCATTTGCACATTTAATGTGAAGGAAGA
AATATAAAAGCACATTATCGTCACTCATCAAAGTCTAAAGGACTTTCTAAAGAAAGAGAT
ACTGGTTTCTGAATCCTATTGACTTATTTTGTCTTTAATATTTATATAATTTTTGAGTAT
AACTTTGTGAGAATGAGAATCTCACTATCAGTGAAATTAATCCTGATCATATCTTTAAAA
ACTTTTTTTTGTTTATTTCATTTTGTTGGAAAGGTAGAGAGAGAGATCTTCATCTGTTTA
TTCATTACCCAATGTCTGCCATAGCTGGGGCTGGGCCAGGCCATAGCCAGGAGCCAGGAA
CTTAGTATAGTTCTCCCCTGCGGGTAGCAGGGACCCAAATACCTGCGCCATCACTGCTGC
CTCCTAGGGGTTGCGTTAGTAGGAAGCTGAAACAGAAGCGGAGGTGGGATGTGGACCCAG
GCATTCCAGTATGGGGTGTGTGCATCCCAAGCAGCATCTTAATCCCAGCCAAACACCTGC
CCCTCAAACCATCTTTATGCTTAACTTCAACTGTGGCATTGTTTCTCAAAAGGGCTCTAG
TGACATAATTCTTTGTTGTCTTGTCTTGTGCTTTGTAGGACGCTTAGCATCTCTGGCTCC
TACTTTTCTCTGCCATTAACATTCTACCACATTAGTAAGAGTCACAGTGTTTCCAAAGGT
CCCTGCTGAAAAGCTGCTGACCTGGATAATTGCAGTGTCTTCCTATCCAGGCTGTTAGCT
TCCTTGTATTTCTTTTCTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTCAAGATGTATTT
ATTTATTTGAAAGTCAGAGTTACACAGAAGGAGAGGCAGAGAGAGAGGTCTTCCATCTGA
TGGTGCACTCTCCAACTGGCCACAAACAGCAGAGCTGCACCGATCTGAAGCCAGGAGTCA
GGAACTTCTTCCAGGTTTCCCAGCGGGTGCAGGGGCCCAAGGACTTGGGCCATCTTCTGC
TGCTTTCCCAGGCCATGGCAGAGAGCTGGATTGGAAGTAGAGCAGCCAGGTCTCGAACTG
TCGCTCATATGGAATGTCGGCGCTTCAGGCCAGGGCGTTAACCTGCTGCGCTACAGCGCC
GGCCCCCCTTGTATTTCATATTTGGTAATCTGTACTAAGGTTTTCTGAGGCCTCGCACAG
TTGCTACCCAAGCAAGTCTGAACTTTAGGCATCTCTTCTAGACATCTGATTTCTTGTTTC
TCTGTGTAAGTCTAGAGTGCCTTTTTCTTCTATTACATTAAATGGCACATGACTAAAATC
CACCTATCCTCAGCACCTTCTCCATGCATACCCTCCAGGAAAATGCCTCTTTCCTGTGCT
GTCAAGCACTTCCTTGCCCAGTCCCTCTTTGTTTTATGGCTCTTACATTCCATCTTGTGT
TGTCTTTATTTATATGCCTGTCTTCTCCTACTAGGTTCCTCAAAGGCAGAGTCTTTATTT
GACTTCCTTGTCTCTCAGCTGTCTAGCACAATGCCTGGCACATAGTAAACATTCAGTAAA
TCTGTTAAATGGATATGTGTTAGCACACTCAATAGCATCCACGTTTTATTTTCTTTATGC
TTAGCAAATGTTGCAACAAATAGATGAATTTTTTTTTTTTATTTTATTTTTTGACAGGCA
GAGTGGACAGTGAGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTTTGCCGTTGGTTCA
CCCTCCAATGGCCGCCGCGGCCGGCGCGCTGCGGCCGGCGCACCGCGCTGATCCGATGGC
AGGAGCCAGGAGCCAGGTGCTTCTCCTGGTCTCCCGTGGGGTGCAGGGCCCAAGCACCTG
GGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACC
GGGACAGGATCCGGCGCCCCGACCGGGACTAGAACCCGGTGTGCCGGCGCCGCTAGACGG
AGGATTAGCCTAGTGAGCTGCGGCGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAACTGAATTGCTATT
TTAAAAAGATACTGGCTGTTCCTATCATGATTCCTAACATTAAAGGGAAATAAATTTTAG
GGTTAGCTCCTACTTGGTCAGTGAAACTATTTTAAAGGATTATGCAATCTATAAATTAAG
AAATATACCCATAAAATGAAGAAAATACTGTTCAACCAGTTAGGTGATTTATTCGGTATA
TTCATAAGGATCTATAGCTTCGTATAACTTGTGTTTTGTTCACTGTTATATTCCCGAACC
TGAAGCAGTGCCTTTCCATCATAATGCAGTAGCATCTTCCTTATTGTTCCCCAGTAGACA
GAGATTTGTACTTGTCATTGCTGTGGGAGGGAAGGCCTACCTCCAGCACTGATGCCAGAA
ACAGTGTATAGCATTACCAGGGATGAGTTGCACTCATAGTCAGTGCCCACCACTTACTTT
CCTGCTTTCACTTCCCTAGGAAAGCAGTCGATGCTATGAAAGGAGTTTCAAAAGGCTTTC
TTTTCCAGTGAGGTCATTGTTCCTTTTTGGTATCTAATGTTAACAGCTTGAAGTTACAAC
TTAATACCAAGATCTGAGACATCATTGTAACTCTTAATAATTTATATTATTAGCAAACCC
AAGTGCTGTGTAGAAGAATGAGTTTCTCACAGTTCTGGAAGATGGTCCTTCCTCACTAAT
TGTGAGCTCTAAGACAGTTGTATTTGTGTTCCAGTTGTGGAACTAAAATCAGCACTGCTT
TGGTTAATGGGAGTCAGAAAACCTCAGTATCTTTGTAACTGCTTAACAGTATTGACCGAT
CGATTGTTAGAGAAAATGGCAGAAGCATGGTACATTATGAGACTCGCCAGGTAAGGATAA
TTAGTATCATATTGTCGATTAAACTGGGTGAACATACCCCTCTTCTGACATCCAAAAACT
TAAGGAAATGCCCAATCACCAGAGGAAACGAACAGGTGAAATGATGGTATTTTTACTAAA
AGACACTAACTAAAAGTCCATAGCTGGTGTTAAAACTGCAGTGTTTGATCTATGGTGTGG
TAAATAATTTTAATGTGAGCCAAATTGGATTTGACTTTTTAAATTGGTAAACGAGTTATA
ATTTAAATTTCTGATTATAGTACTTAAATGCAGTTAGTAATATTACTCATCACTAGCTTC
TGGATAATTATATCATAGTTTCAGGAGCAGTAATGATCATCATCAAGTAGATTTCTTTTC
AGTGAATAAGTATATAGAGAGCATACTAACCATGTACAAAACTGTTGGGTCCCTTCCAGC
ACTTATTTGTTCAGGCTTAATTTCCAAAGATAAATCATAATGTAGTATTAATGATAAATC
TAATTTGAAATTCCCAGTTGGGGGTGAAAACATTATCCAATCTCAAAATGGCCATACGAT
AATACAAGCCACCTGCTCTTAATGGAATATAATATGGCTGCTTTACATAGTCTGGGAGGT
CTCAAATATTTTTTAAGTTGTAAGCTGAGAGCCAGCCCAGACTTCAGGATATATTTCAAG
AAAATGAAAGTGGATGATACAGTTTTTTAAGGACTGGGTAACAAACTTGAAATAATTGTG
AATCTTTTTCGTATTTAATAAATTGAACCATACATTTTATTTTGGATTCTGTTAGGCAAC
TTTAGCAAGTATAGATGCTGAGCTTCAGAAACTTAAGGAAATGACCAACCACCAGAAAAA
ACGAGCAGCTGAGATGATGGCATCGTTACTAAAAGATCTTGCAGAAATAGGAATTGCTGT
GGGAAATAACGATGTAAAGGTGAGTATTAGGAATAATTATCTGAAGGTAACATACACTTT
GTTCATGTTCTTTTCATACTCATTCATCCTCACAGCAGCCACGCGTGCTGGGTGAGGAAG
TAGGGCAGGAATGAAGGGCACTTACTCAGTAAGCAGCATTTATTGGGCCCATGTTTGGTT
CTTTACTATGTAAAGATTTTGTACTTAGGAGCAGGTGTTCGGTGCAGCAGTTAAAATCCC
CTTGGAACGCCCACATTCCATGTCAGAGTGCCTGAGTCCCAGCTTCGCTTTTGATTCCAG
CCTCCTGCTGTTGTACACCCTGGGAAACAGCATCTGATAGCACAAGTACTTGGGTCCCTG
CCACCCACATTAGGGACTCGGATTGAATTCCTGGCTCCTGGCGTCAGCCTGGCCCAGCCC
TACCTGTTGCAGGCTTTTGGGGAATGAACTAGTGGATGAGATATCTCTATCGCTGTTTCT
CTGACTTTCAAATAAATCAAAATTAATAAATTAAAAAAAATTTTTAAAGATTTTGCACTT
GGAAAATATCTATAAATTACCATTTGTGAAGTGTGTGGTTGGAACTGCAATAAAGCTCAG
GAAAGAAACTCATATGTGAATTTGCTGTGGATCTGTATCTATTCTGTTTTGTTCCCAGCA
CTTTTTTGTCTGTTCTTTTGCCGATATATAGAAATTCCTTTTTTTTTAAAAAAAAAGATT
GATTGATTTATTTGAAAGGCAGAGTTACACAGAGGCAGGGAGAGGGAGAGAGATTGTCCA
TCCACTGGTTTACTCCCCAAGTGGCTGCAATGGCCAGGGCTGGGCCAGATGGAAGCCAGG
AGCCAGAAGCTTCTTCAGAGTCTCCCATGTGGGTACAGGAGCCCAAGGACTTGGATCATC
TTCACTGCTTTCCCAGGTCCACAGCAGAGAGCTGGATTGGAAGTGGAGCAGCTGGGTCTC
GAACCCAGCTGTGCACAGCGCTGGCCCCCTGTATTTATTTTTTTAAAGAAAGGTTTGTGT
GTGTGTGTGTGTTTAAAAGAGAGGGAGGGAGAGAAAGAGGCCTTTCATCTGCTGGCTCAC
TTGCCGGATGGCCAGAGTAGCTGTGGCCGGGCGGGGCTGGAGCCAGGGCCTCCGTCCAGG
TCTCCCTCGTGGATGGCAGGGACTCGAGCGCCTGCGTCTCCATGCACTGCTTCCTAGGGG
CCTTAGCAGGGCGCTGGGTGGAAGTGGGGCAGCCGGGACTGGAAACAAGCACCGCGGTGT
GGGGGGTGGGTGTCTCCATGCAGCCCAGGGCCCGCCCCAGTGCTCTCAGGCCCCCGCGTG
CCCAGCGCTGAGTGCGGTGGTGACGCCGCAGGCCCTGCAGCCGTGGCTCCCGTGGCGTTC
CCGGCACTGGCCGTCTGCGTTCTGGGTCAGCCTTGCTGGGGTTCTGGGAGTTGCACGCCT
GTGTCGCCGTCTCCTTGGCTTTTCCCCGTCGCGCGGCTTTCCCGCCTTCTGCCTGCTTGT
GTCTGTGTCTCTGGGCTCTCAGTGGGGACTCTCGCCCTCCGCTGTTGTGCGTGGGTCTGG
TCCCAGCAGCACCGGGCAGACGTGGGGGGCACGTGTCGTGCAGCTGCGGGGCCGGTCCAT
GGTTGTCGCTGAGACCCCTGTGGCTGTGGCGGCCGAGCTCTGGCGTCTCCACCAGGTCCT
GTGTGTCCCGGCAGCGGCTGCTGAGGGGCGTCTGTCAGTCTTGGACCGCTCTGCCGTCTT
GCGGATCTGTCCGGTTTTGCACCCCCATGGCTGGGTGCTTGTCCACGGCTGCTGCGTCCC
GTTGGCGAGTGACGCTCGGATTCTGCCGTGACGCTGCCCTCTGCCAGCGCCCTCTCTCCC
GAGGTCGGCTTTACCTGCCTGCCTCTTGTGGGCGCGAGGTCTTCTCCCATCCGTGACCTG
CGTTCTGCCCGCACCACGGAACGTGGAGTGAATTTCTGTGCCCGCCTGCGACTTCTCTCC
CCATCTGCTGACTTTGCTTTATTTCGCTCATGTGTGTTTTACGTGATTGTTGTTTGTTGG
GGTTTATCTTTGTTTTAGATTTTGCATTCCTTTTTCTTTTTTCTATCTTCTTGTGGGTTA
TTCGAATTTTTTTAAAAAAGTTTTATTTGAGGCCGGTGCCGCGGCTCACTAGGCTAATCC
TCCGCCTTGCGGCGCCAGCACACCGGGTTCTAGTCCCAGTCGGGGTGCCGGATTCTGTCC
CAGTTGCCCCTCTTCCAGGCCAGCTCTCTGTTGTGGCCAGGGAGTGCAGTGGAGGATGGC
CCAGGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGCCATC
AGATCAGTGCGGTGCGCCAGCCGCGGCGGCCATTGGAGGGTGAACCAACGGCAAAGGAAG
ACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAAA
AAAAAAGATTTATTTGAAAGGTTGAAAGGCACAGAGGCAGAGAGAGAGAAATCTGTGCTC
TGGTTCTCTCCCCAAATGGCTGCAATGGCCAGGACTGGGCCAGGCTGAAGCCAGGAGCTC
CATCCGGGTCTCCCACGTGGGTGCGGGGGCCCAAGCACTTGGACCATCTTCTGCTGCTTT
CCCAGGCCACAGCAGGGAGCTGGATGGGAAGTGGAGCAGCCGGATGCTGGCGACACAGGC
AGTGCCTCAGTGCTGCCCCTCTCTTGAATATTTTAAACACTGTTTCATTAGCAACATTTA
CTTGGTCTCCCGCCTCTGGGTAGCTTTCAGAATGGTTACTCTGTGCTTTCCATCAGGCCA
GGGCATTTCTGAGGTTAGCAGAAAAGTGGACAGAGCCCTCCTGCGCACGTGTTTATCCCC
GTGGTGTGCGAGCTGGAACGACGCTCGCCGTCTGTCCCCCTCGTGGTCCCCTGCCCCGTC
CCGGTCACAGAAGTCGGATGCTGCCTCTCCGTCCTTTATGACCCCGCGGACCGTGCTGGA
GCGCTGGCCTCGGCGGGCCACCGTGATTGAGAGAGCTCGGGCTGAGGAGGAAGCGTGCTG
CCATCCCCTTTCTTCCTGATGTTCCAAGGCTGCTGCTTGCATAGTTTCCTTCTCGTGTAG
GGAGGTTCCTTAGCCATTCTTTCTTTTTTTAAAAAAAATTTTTATTTATTTAAAAGGCAA
AGTTAGAGAGAGAGAGAGAGAGAGAGAGAGAGGTCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTATAAAGAAACAGTTCAACTGTAGCTCTCAGGCAGGTCCTGCAG
GAGTGATCCCAGAGACACTGCTATAACAGATGACAGCCCCATGCAGGTTACTGTTCCTGA
AGACATTAGAATGGGACAGGATATGGTGGTGAAGACAATGATATTGATGATCTTGACCTT
GTATAGGTGTGAGTATGTATCTTAGTTCTTAAAAAAAAAAAAAAAGCTTAAACAGTAAAA
AAAAAAAACCTCTTTCAGAAACAGAAAATAAGGATCTAAAGAGGATCTAAAGGAGGAAAC
AATTTTTGTACAGTGTACAATGTGTTTCTGCTTTGTTATACAAAAAATCAAAAATTTAAA
AGTATATAAAGACTAAGAAGCTGTATTAGTGAAGAAAATTTAAAAATATCAATTTAACAT
GTAGTATTTGCAGTCTACAGCAATGTCTGTTCTAGACCTTCATAATCTTACTCACCACTC
ACTCACTGACTCACCCAGAGCAACTTCCAGTCCTGCAAGCTCCATTCATGCTAAGTGCTC
TATACACTTAAACACTTTTATGTTGCTTTTTTCCCATGTTTAGCTACACAGATACCATTG
TGTTATAATTGTCTGCAGTATTCAGTTCAGTAACGTCTATACAAGTCTGTAACCCAGAAG
CAACATGCTAAGCCATGTAGCCTAGGTACAGAGAAACCTGTACCATCAAGTCGTGTAAAT
ACACTCTGTGATGTCCACCATGTCATGGTGTATTACTAAATAAAATCTGTCCTTAGCACT
TAAACCACTATTGGCTTGATCTTTGACAGACGGCTAATAATGAACTGAAAACAAGGAAAG
TATTAAAGACAGGGAGAACAGGCTTATTTGCTTTTTTTTTCTTCAATAAAGCTGAAAAAA
AGTGAAATCAAAGATGTTGTAAGAAGATGGTGATTGTGGGTAGCATCCAGGTGTTGGATG
AAGTTGGACACAATTCAGAGAATAAGTGAACAATTAGTCTTAGGGAGAGACAGTTGTCTT
TTTCTGGAACTAGAGATAAGACGACAGGATCCATTAGATATGATGGGGAATCAGACGACA
TAGAATAGGTCGTAAGTGTGAGAAAGCAAAAATGTGATGTTCATTCATCAGCCTGGACCG
ACAGCTACGATGAAGGCTAACTGCAAGGTGAGGACAGGAAACAGGTACTTCTCTCCGGGA
CACGTCACATCCATAAAGTCACAATGTCCTTTCCATCAATTTCTTACCCAGAAGCTTTGT
TCTTTCGAACCACCGACTATCACAAACTATTGAAATTAAAGCAGTAAGGATAAAACATCC
CACTCTTCCCTGAGGAATCTAAGGCACAGGGAAGCAGCCTGGATTCCCAAGCCAGGTGGA
AAGCTTCGGAAAAAGCGGTTTCTCCGCATTAATTCTGTGGTGTTCAAGGAAGCAGAACCT
CTGCTCCTCTGTAGTTCAGACCCCAGGTTGGTGCCTTCCCTCAAAGCTCTGCTTGGCATG
GCGCCTCTTAAACCGCCGCTTCATTTAACTTTTTTTTTTTTTTTTTTAACCCAAACTGCG
CTTTCCCCAAAGCCCTGTGGTAACCCAGACCCCCTTGCACGGGAGGATCTTTTATGGTAA
TCCATCTTCCACACACGAGGGCGAAGGCACTTTGTGCTCGGGTCTCCTCTTCACTTGGAG
CTCCCACATTCCTCCTAAAGCTTTCATAAGGCAAATCTTTGTTATTTAGGGTCAGTCACC
TCTTCGGAAATTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCCCCAGCCGCCTTTGGAAATGAATGACTTACCACGTTTAACA
GTTACAAATGGCAAATTGAAGACTGTCCAGAGAAACAGTGGGTTTTCCTCTGCCGCTGAT
CAGTTTTGGTTTAATCGTGTAACAGAGCTAGCTGAGTTCGATGAGGTCAAATAACGTGCT
GAGAAAGATCCAGAATCTCACTGTGCTTTTTAACAGGGGGTAACAGACTAGGAAAAAAGC
GTTTACTTCATATCAGTGTGTGATTTAAAAAGAAAGATTCTAAAAAAGATAAAATTGACC
AGCAGACAGGACTGTAGTTCTTCAGGGTTTAAACTGAAGGTTTGCAAAGTTCACATCTTG
AAGACGAAGAGTTGTTAGGTCATTAACAGCTACCAAGTACTTCTGGGTAAAGATGTTAGG
CCGGTTCTTTGTTAGCAAGTCCTCTAGAAAAACTCCTGGTATAAATGACATCATGCGAGG
TGGAGAAGTCAGGCACAGTAATCCTTTTTCCTTTAGCGTGGTGTATTTTACATGGAATCA
GTAGAAGCTTGCAAGGCCTGGATTAGTTGTCAAAACTTGAGGCCACTAGTTTCTTCAGGG
TGTTTGTGGTTACTCAGCTTCATCTACAGTTGACTCAACAAACCACTTTTTCCTTTTACG
CTGTGTTAAGCTTCTCTTACGGATCCCGATTTCTGTGTGTGTATTGACACAAATCTCCAA
GTATCACTAAGGTTCTTTAGGATTCACAATGTATTAAGATCGGGGTAGAAGGTAACCTTC
TGTTATGGCTCAAATATGACATAAAATGTGAAGAGAGCTAAAAGAGGAAGAGGTAATTAC
CACAGGAACCATGCATTTATTTTAGGTTGTTTTCCTTTGGGAAAGGTAAATGTATGAATT
CTGTTTTTCAGAATTTCTTCAGTACTGTAAGTATGTTGAAATGATAATGAAAAATAATGG
GTAGGTGATTGGTTTGTGATTCAGTAGTCAACAGTTGGTGACTCTGTAGGTAAACTGGTG
AGCATTTTAGTCTGGTGTTTTAAAGTGTAAGCAAAAATACATTACAACCTTAAAAATTAT
AAAGCGACATGTCTAGTTCATTATTTTCAGGAACTGGTTTCTTGTATATAACTACATTAA
TTGCACAGAAGTCTGGTAAATGAATTAAGAGCAATTAGGAGGAGTGAAATTAAGAAAATC
ATCTCTTGGTTTGTTTTGTTCATTTTGTTGAATTCTGATCCTGATTCAGACTAAATGGGA
GAGAATTGCTGCAATGAAGCATTTAAAACTAAATTATTGTAAACATGATTGAAGAAAATT
TTGTACAGTCCTCTAGTTAAGTCAGAATTCAAAGTATTTCAGCTTTATGATGTTACTGAA
TTATCAGTGCTCCTGGAGAAAGTAATTTTTTAAGATTTTCTGATTCTCTTCTAATTTCAG
TTTTTAATATTTTGTCCAAGCTTTGTTCCTGTTAAGTCAGGATATCCACATCTTTTGATT
AAGTTTGGTGAGTGCTAAAAATATCACACTGAAATGAAGCAAATGAATATCATGAAAAAT
TTTAAATGGTACAAATATAACTCACATATTTGCTTTAAATTAGAAAATTTGTTATCCACA
AGGCAGGGTGGACAAAGGAAGCAGTAATGTGGTTCAAGTGAACTTGCTAAAAATACCAGA
AAAAAGTCAGGAAGAAAAATGACTGATGTGTATATTTATGCATCATAAAAGTAGTACTTG
CTCATTTGATTAAGTATCCTTGCATATCATTGATCCTTATATGGAGTACCATAGAGGTTG
GCAGAACTAAAAACAGGCTGCTGTAGTTCATTGATACTAGAAGAGACTAAAACTAATCAG
ATCATCTTGCTCATTTCCTTGCCTAAAGCAAAACATGATTTGTCATGTCAGGTCAATGAG
GATTTGGTGTGGGTGCCCTCTTGATTAAGAATGAAATTGAAAGAGAAGAAGGAACCATCG
GCTGTACCCTTACAGCTGTAGAACTCGTCACCGCAACCAAGCATGTGAAGGAAAAATTTA
ACTTACAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATG
TTTTGACTCTCCATGTAAAATCTAGAAATCAGTTTGTTGACTTCCACAAAATAGTTTACT
GTGATTTTCATTCACCATATTGAGGAAGCAGTGACTGAATTTTTTCCTTTTTTAAAGTTT
TATTAATTTATTTAAGAGGCAGAGTTACAGAGAGAGGGAGAGACAGAGAGAGGTCTTTAA
TCTCCTGGTTCACTCCCCAGATGGCCGCAACGGCCGGAGCTGGGCTCATCCTAAGGTAGG
AGCCAGGAGCTTCCTCTGGGTTTCCCACATGGATGCAGGGGCCCAAGGACTTGGGCCATC
TTCTGCTGCCTTCCCAGGCCATTGGCAGGGAGCTGAATTGGAAGTGGAGCAGCCAGGACT
GGCGCTCATTTGGGATGCCGGTGCCACAAGCAGAGGCTTAACCCACTATGCTACAGCGCT
GGCCGCAGTGACTGACTTTCATATATTAACCTGTATCCTGCAACCTTGCTATCATGGCTT
ATTCGTTCCAGGAGTGTTTTTGTTTTGTCTCTGTTTTTGTTTTTTGTAAGCAATCATATC
TGCAACAACAGTTTTATTGCCTCCTATCCAAGATGCATATAAGTTTGACATTGAGTATTG
GAGTTTTTTAATGAAATCTATAAAAGTCAAGGAATGTGCAATGGCCACAGCTCTTCCTTG
TTATACTCAAAAGTCATCATTTCCCTACCACCCCAAACATCCTCTTGTTAAATTTTAAAC
TGAGGGGCTGGCGCTGTGGTGTAGCAGGTAAAGCCACCGCCTGCAATGCCAGCATCCCAT
ACGGGCACTGGTTCGAGACCCACCACTGGCCGTAGTGGCCATTTTGGGAGTGAACCGTGG
ATGGAAGGTCTCTGTCCCTGCCTCTGCCCCTCTCTAACTCTGCCTTCCAAATAAATAAAT
GAATCTTGAAAAATAATTTTAGACTGAACTTGCACATTGTTGACAATGAATTTATGAAGA
TGTCTTGTGAAAAGGAAATGTAAAACTTGACAGAGGCAGAAGTCAGTCACTTTTTTTTTA
TTAGGTTTCCATTTATTTTATTTCCTCATAAGCCATGTATTAACATACCAAGTTTGAAAA
AGTAGAAAGGCAAAAATTAAGCTCTGCTTCTATATCCTTTATTAAAAACGATAAAAAAAA
AAAAAAAACTAGCTCCAGCCTTTTTGTGAATGTTGAATAACTGAAGGTTCTGTAATGGTT
TGAGAACTAGAGTCTAACTGGGAAGACGCACTGAACTTTCTGCTTTACTTTTTTATTTTA
CTTTCTCCTCCCAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACAGCTGGAGCTAGGCCGATTGGAATCCAGGAGGCAGGAGTCTCCTCTGGG
TCTCCCACATGAGTGCAGGGGCCCAAGGACCTGGGCCATCTTCCACTGCTCTCCCAGGCC
ATGGCAGAGAGTTGGATAAGAAGAGGAGCATCCAGGACTCGAACTGGTGCTCATATGGGA
TGCCAGCATTGCAGGCGGCAATCTTACCTGCTACACCACTGGGCTGGCCCGCTTAACTTC
TATTTCTTTGTTTTTTTGATTCTTAACTGATAAAATTTTTATTAGAAATTAAGGGTTTAG
AGGTTGGTTTTTGTTTTTTAATAGAAGTCGTCCTCTTAGTTTACCTAGAAGACATTTCTC
TACTTCGGTAATCATGTTCACATACATGGGATGGGTGTAATGATTTGAATAGAAACCAGA
AGATGGCAACAACAAAACAGAAGTTTGGGGCATAGATCTAACTAGTACTTAATGAAAGCA
GTAATAAGGATTCAAGGAAATGAAAGACATGGAAAAATGAAATCATAATTTTTATTTAAA
ACATGAAAAATATTGGATGACCAAAAGGTCCTATCTCTTTCTGCACCTATGGAGGACATG
ATAACAGAAGATATTTTGAGTGTCTGAAAAATGAGATGATAGAGTTCAAAAAATTGGGAC
AACGTTTAGCCTTAGCAGTTAAACACCTGCGAGTCCCATAGCTGAGAGCCTGGGTTCAGT
GCCCACCTCTGTTCCTGGCTCTAGTGTCTGACTTGTGTAGACCCAGTGTGACAGAGGTGA
GAGCTCAGGTGGTTGGGATGCTGCACCCGCACTGGAGACCTGAACTGAGTTCCTAGCCCC
AGCCATGGTGAGCATCTAGGGAGTCAACTAGCAGGTGGGAGCTCTGTCTTTCTCTGTCTC
TCAAATAAATACATTTAAAAATTAAAAGTGATAGGGAGCAGCATCGTGGCAGTAGTGGGT
AAAGCCACCATCTGCAATGTTACTTCCTGTCCTGCCTGCTCTACTTCCCATCCAGCTCCC
TAATAATGGCCTGGGAAAGCGTTGGAAGATGGCCCGGGTGCTTGGGCCTCTGCCGCCCAT
GTGGGAGAACCAGATGAAACGCCTGGCCCCTGGCTTCAGCCTGGCTCAATCCTGGTTATT
GCGACCACTTAGGAAAGTGAACCAGTGGATGGAAGATCCTTATGTCTCTCCCTCTCTAAC
ACTGACTTTCAAATATATGAATAAACCATAACCCTCCCCACCCCAAAAATATTAAAAGTA
TGGACAAGACCTTTAAAAATTTTTGTAATGACAGCCTTCAGAAAATTATGATGTTTATAT
ACTGTTTTTTTTTTTTCCTTTTGTCAGCCAAAACCAGAAAATGATGTTAGAGCAGGAACG
TCTCAGAGTAGAACATGAGAAGTTGAAAGCTACAGATCAGGAAAAGAGCAAAAAACTACA
TGAACTTACGTGAGTAACTGCTTTAATTAAAATTTAAAAATAAAAACTAGAGGACTGTAG
GCATTGCCTTTGGATACGTCTAGTGGGTACATGTTTTACTTTCTATAGACTTGAGTGTAT
TTTTAAGAAAATCTTTGGAGTTGTTTTGATTTACATCTAAAAACTGAGAATTTATGCTGT
GTTTGACTGAAAGCAAGGTCTTACCCTTCCGCCCACTTGGTATATCAGTGTCACCATATT
AGTTCAGGATTTATCTTCAAAATGAACCTAGAACATGGCGGTCGGTAATTTAAGTGATTG
CAGTTCTACCCCAAGATGAGTTTTTTCAGATTGGATCTTGCACAAGAGAACCTTACTGTT
TGCAGTCTTGTCTTTTGGACAGAGGTTTTCATTGCTTGTTCCCCATGAACAGAGTTGGTA
CTCAGTTTTGTAGAATCAGAGCGGTTAGGACACTCACAGTTTTTCATGTGCCTTGAGTTT
GTGAGAGACACGGTGCAGGTGAACTGCTGTCCCAGGATGGTCACTCCATCAGGACCTGTG
CAAGGGGCTGTGTAGACGTGCTGCTGCATTGCAGCCGCCGTTTTGTTAGAATAAAGATTT
TAGTGTAAAATATTTTACTCTTTGACAATTTAGTCTGTCGTTCCCAGTTAGTATCATTTT
GGATAAATAGCAGAATCCCATATGACATAATTAAAAATCTAAATTAGGACTGTTCGTATT
CTTGGAATACTGCCACATTTTATTTCATGTCTTCCATTGCTATATGAGGAGGGTTTTTTT
CCTGATAAACTATAGATTTGGAAAGAGATTATCAGGAATATAAAATTCCTTTGAAAGAAA
TAGCATAGATAAACTTTAAAAAGAAGCATCTTTCATTTATTTGAATTTATCGAGTCCTTC
AGATAAAAATATTGAATGAATTCTTGTGCTAAAGCTAGAATTTTAAGGATTCAAAGATGT
AACCATGCCTGTATATTCTCCCACTGTTAGGGTCATGCAAGACAGACGAGAACAAGCAAG
ACAAGACTTGAAGGGTTTGGAAGAGACAGTGGTAAGAAAAATGAAGATGAACGGGGCGAG
GTCTTGTGCGGGCTTTTATCCCATTTCCTAGCCTTGAAGTCTGAATTCTAAAAGTACTGC
TATACTTGATTCCAGGCAAAAGAACTTCAGACTTTACACAACCTGCGTAAGCTCTTTGTT
CAGGACCTGGCAACCAGAGTTAAAAAGGTAGCGGGACGTGCCCAGGGGGTGTGGGAAGAG
CTGGCTGTGTGCAGTTCGTTTTGTAGCCTCTGAAATTCGGACCTCCTTCTCTCAGAGCGC
CGAGATCGACTCTGATGACACTGGGGGCAGTGCTGCGCAGAAGCAAAAAATCTCTTTTCT
GGAGAACAATCTGGAACAGCTCACTAAAGTGCACAAACAGGTAATGCAGGCTCTGTCTAC
TGCTTGCTGCAACATCGCAGAATCAAACTGCACAAGTGGCAAGTGTTTCAGTCTTTCCAG
TCCTCAGAAATGTGTATGCTCTGGCCATTCCATTATTTTACCAGACGATATGAGGAAACC
ACCAGCAGCTTTTAACAACCCTGTAATGTAGACCAGTGGAAACATGTTTTTAATCTCTCT
ATAGGAAATTCTGGGCTGTCAGCTTTCTTAACTTATTCATGGTAATCTTTTTGTTTTAAA
TATTTATTTGAGGCCAGCGCCGGCACCCCGGGTTCTAGTCCTGGTCAGGGCACTGGATTC
TGTCCCAGTTGCTCCTCTTCCAGTCCAGCTCTCTGCTGTGGCCCGGAGTACAGGTGGGAG
GATGGGCCCAAGTGCTTGGGCCCTGCCACCCGCATGGGAGACCAGGAGAAGCACCTGGCT
CCTGGGCTTTGGATCAGCGGAGCGCGCCAGCCGCAGCGGGCCACTTTGGGGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATACAAATATATATATATTTGAAAGA
GTTTCAGAGAGGTAGAGACAGAGAGAGATGTCTTCCATCTTCTAGTTCACTCCCCAAATG
GCTGCAAAGGCTGGAGCTGAGCCCGTCTGAAGCCAGGAGCTTCTTCCAGGTCTCCCAGTT
GGGTGCAGTGGCCCAAGGACTTCAGCCATCATCTTCTGCTTGCCCAGGTGCATTAGCAGG
GAGCTGGATTGGAAGCAGAGCAGCCAGGATTTGAACCGGTGCCCATATGGGATCCCAGTG
CTGCAGACTGGGGTTCACTTGCTGCGCCGCAGCACCAGCCCCTCTTGGTACTGTGCTTGT
TTGGTTTTGCTTTAAAAAAAAAAAATGTATTTTTATTTGAAAGAGTTACAGAGAGAGGGA
GAGAGAGATCTTCTATCTGTGGTTCATTCCCCAAATGGCCACAACAGCAAGGGCTGAGAT
AGGCAGAAGCCAGGAACCAGGTGCCTCCTCCTGGTCTTCCACTTGGATACAGGGGCCCAA
GCACTTGGGCCATCTTCCACTGCTTTCCCAGGCACATTAGCAGGGAGCTGGCTCCGAAGT
AGAGCTACCAGGACTCAAGCCAGCACATATTGGTGTCACAGGTGGCTTAACCTGCTACAC
CACAACACTGATTCCAAGTTTACTTAGTTTTTTAAAGAGCAATTATGAGAGGCCGGCGCT
GTGGTGTAGCAGTTAAGCCGCCATCTGCAATTCAGGCATCCCATATGGGTGCTGGTTTGA
GTCCTGGCTGCTCCTCTTCTGATCCAGCTCTCTGCTATGGCCTGGGATAGCAGAAGATGG
CCCAAGTCCTTGGGCCCTTGCACCCGTGTGAGAGACCTGGAAGAAGCTCCTGGCTCCTGG
CTCCTGGCTTCAGATCGGCACAGCTCCGGCCGTTGGTGGCTATCTGGAGAGTGAACCAGC
GGATGGAAGACCTCCCTCTCTCTCTCTGCCTCTCCTCTCTCTGTGTAACTCTTTCAAGTA
AATAAAAATAAATAAATATTTAAAAAAAATAAAAAGCATCGGGCTGCAGAGTTGGGAAAT
TTTGCATCCAGCCCCAGAGCCACAGCCGTCAAGGAGGCTGACTCAGAGCCCTGGCATCCC
TGAGTCTGCTTCAGAAAAAAAGAGCAATTATGAAAGTCTCATGCCTTCTCGCATCATCCA
GCTAGAACCATTGTTATCTTGTGTTCCTTTCTAGTTGGTACGTGATAATGCGGATCTTCG
CTGCGAACTTCCCAAGTTGGAGAAGCGACTGAGAGCTACAGCCGAGAGAGTGAAAGCTTT
GGAGTCGGCACTGAAAGAAGCGAAGGAAAATGCCTCTCGGGATCGGAAGCGCTATCAGCA
AGAAGTGGACCGCATCAAGGAAGCAGTCAGGTCGAAGAACATGGCCAGGAGAGGGCATTC
GGCTCAGATCGGTTAGTGGCTGCCTTGACTCCTCTACCCCCCGCTCCCTTCTGATGCTTT
CATGTCGTTGACGTAATCTGACTATATGCAGTGTTGCCCTGGGGGTCCTTGTCTGGTTTC
TAACTTGCTCAAGAGTGGTACTGTTAGGGAGGGAAATGGAGGGCTAACGACATTAACAAG
ACAAGAATAACCAAGAGCTGGAGGAGCAAGCAGCCATGGTCAGAGTAGGAGAGACTGTAG
AGCAGCGTCGTAGGCAGAGAGAAGTGCAAGAAAAGACGTCGTCGGCTGTCGTTTCATGTG
TCAGAATAATCCTTGGTGCGGGAATAGGATCTTTAACAGGCTATGGGTTGTATGTGTCCT
GGAGAAAAGGATAGGGCCAAAAAGAAAAAGAACAAAAAGACACAGGGAAACACCTGGGAC
TTGATTGTGAGTAGAGAAGGATCAGCGGAGCATTGCAGTCACGTGTTCGGCTTTCTCCTA
AAGTCACTGTTTGTTTTTCTTATTAGCTAAACCCATTCGGCCCGGGCAGCATCCAGCAGC
TTCTCCAACTCATCCAAGTGCAATTCGCGGAGGCGGCGCCTTTGTTCAGAACAGCCAGCC
TGTGGCCGTGCGGGGCGGCGGAGGCAAGCAGGTGTAACGTCTGCACAGACTGCCGGTGTG
TAGTTGCTGGCTTTGCGGTCAGAGCTGTGTATGGAAGCAGGGAGCCATTAGTTAGTCTTT
TTTTATTCCTATGAGTCCTGACTTACTTTTTCTTGACATATGTAATTATAAAAGTAACAA
CACAATTTCTCCTGGTCTTTTTTTCATAGTTTAAGTCAAATCATACATTCAAATTTATGT
TTTTATCTGTTTTTAAACCTAACATACTACATCGTTTGTAATAAGTAAGTGTTCTGATTT
ATTAGTTTATTTGAAAAGCAGAGTTAACAGAGAGAGAGAGAGAGAGGGATCTGGTTCACT
CCCCAAGTGGCCTCAATGGCTGGGACTGGGCCAGGCTGAAGCCAGGAAACGGGAGCTGCT
TCTGGGTCTCCCACAGGGTGCAGGGGCCCAAGCACTTGGGTCATCTGCTGCTGCTTTCCC
AGGCCATTATCAGGGAACTGGATCAGAAATGGAGCAGCTGGGACTTGAACCAGTGCCCAT
ATGGGATGCTGACACTGGTGGCTTAACCTGCTGTGCCACAACACTGGCTAGACATTCTCT
TTTATTAGACATTTAATGATGTAAATTTTTTTCATATTTGAAAATTTCCGAAATTGAAAC
TTCCAGATAAGAAAGTATCTTTTATACTACTTCACCCTATAGATCATTTCCAGAAGATTC
CCAGTGCAATTACAAAGTATTAATGTTTTCAAAGCCCTGGGTACATATTAACACATGGCT
TTCTAGAAAAATTGCACAGAATCAGACTGGCAAATGACTCAAGGGTACTATTTATTGCAT
CCTTATCAGCACTGAACATTAAATGTTTTTAAGATTCTTACATAATAGCCAAATAAATAG
CATCTTGTTGATTTATCAGTGAAGTTGGACTTTTTTTTTTTCACATCTTTGTTGGCCTGT
TTATATTTCCTTTTTTTTAATGAGTTATCTCTCTTTATCTTTTCTGGGTGATTTTTCTAA
AAGACTTTTGTATTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1088, 9127..9200, 10444..10548, 11351..11399, 11944..11999, 12089..12176, 12357..12481, 14707..14811, 14912..15057, 16095..16243, 17641..17834, 19046..19114, 22733..22939, 24895..25038, 65054..65242, 66311..66428, 66529..66590, 66691..66800, 69207..69308, 70290..70350, 70455..70526, 70615..70719, 72514..72730, 73226..73356
1001..1088, 9127..9200, 10444..10548, 11351..11399, 11944..11999, 12089..12176, 12357..12481, 14707..14811, 14912..15057, 16095..16243, 17641..17834, 19046..19114, 22733..22939, 24895..25038, 65054..65242, 66311..66428, 66529..66590, 66691..66800, 69207..69308, 70290..70350, 70455..70526, 70615..70719, 72514..72730, 73226..73353
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved