Oryctolagus_cuniculus Locus RPL30
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RPL30
Oryctolagus_cuniculus
RPL30
GeneScaffold_2731
SNORA72
3058..3189
4447
CCCCAAAGTCGGAACTCTGGGTCTTCCATGCGGGTGGCAGGACCCAAGTCTTTGAGCCA
TCACCTACTGCTTCCCAGGGTGTGCATCAGCAGGAAGCTGGATTGGAAGCAGAGCAGGGA
CTCAACCCAGCACTGGGATATGGAATGCAGGATCCCCAACCCAGTCTTAACCGCTGCGCC
TAACTCCACCGGAGCCTAACACTATGGATGACCCCTCACTGGACATTTACACTAAGGTCC
AAAGTTCACAGCAAAAATACTTTTAAAAATTAAAACTGTTTATCGCACTTCCTATGCAAG
TACGGCTCACAGGTCCACACTAACACTGCCGTAAAAGGTGAGTTTGTGGGAGCCTGCGCC
GGGAGCCACCGTTTCCGGGGCCAGTAACTCAGGCAGGATCAGGCGAGAGCCGGAGGAGGG
AAAATGCAGATGGGGCGCACCAGGGTCCCCCGAGCCTCCCCAAACGCCGCGCCTACGGGC
TGAGACCTCCTGGGCACCGAGACAGCGGCTGCACCCGCCGCCGGTTCTCACAGAGCCTGC
CACCTCATCCGCAGGCGGCTTCTCCCACTGCCGCCTGGTTCAACGCTCCTCAGTTCCTAC
GCCCGCGGCTCGCACCACAAAAGCAGCATCACCCACCGAGAACCCTAACGTTACAATACG
GGGATCCGAACACTCAGGTCACCATACTGTCCCGCGGTATCCTAGAGCAACCAGGAACCG
CGCTCCTCCTATAGCTCGCCCCTTCCGCTTGCGATTTGCTTCCGCTTCCGGCTTTGCGTT
CGGCTCTGCCGTGAAGAGCTTTGCATTGTGAGAAACTCCTTCCTTTCTCGCTCCCCGGCC
CATCTTTGCGGCTGCACTTGGTGAGTGGTCTCCACCGGGCCGAGGATTAAGCAGGCTGGG
GATTCCTGCGGGTTGCCGTTGGAAGCTTCGGATCCTAATCTTCCTGCCCTGTCCTCTGTT
ATGTTCCAGGTTGGAGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCCAAGAAGA
CGGTGAGTGGGGCGCGCCAGGGCTGGAGGCCGATTCACGTGGAGAGATCGGGCCGTGGCC
GGGGCGGGCATCTCGGAGCTCGCCGGGGCGACAGCGTTGACTCGTAGCATTGGGAAGAGG
CCGGAGGGAACAGAGAGACCCTTTCAGTGGCTCCGGACCCTCGATGGCGGAGGTTTTAAG
AGGCTCGGCTCCAGAAGGCTGGATTCAGGTTTGAGGTGATCGCAGACGAGGCCTTCAGGC
CCGTGTTACATGTTTGCTTTGTAGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCTCCAG
CTTGTGATGAAGAGCGGAAAATACGTGCTGGGGTACAAGCAGTCTCTGAAGATGATCAGG
CAAGGCAAGGCGAAGCTGGTCATCCTCGCCAACAACTGCCCGGCCCTGAGGTAATGGGAG
GAAGTGCACATGCGATCCCTACATTCACGTTTTCCAAAAGACAGTCGCAGGATAACCAGT
ACGGCTGCTGCTAATCGCGAGCCACACCTCCGGCCGCCTAGACAAACCCTGTGCTTGGCT
TCTCTCTAACCTTATCTTTGAGCAGAATTTTAAGTTTTCAAGTTGGTTTAAAGATGCTTC
GTTTTCTGCACTTATTTTGTAGCATAGAGAAGTCCAGGCTGGACTGTGGCTTGCAGCCTG
TCATAGAATTACTTAGTGTATTTCTCAGCCAAGGCTTATGCTTGAAGTCGCTGTTTTGAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTTGCTTTGATTGTA
TCTAGCCTTTTCCATGAGCACAGGTGATGTCTTGAATGTAGTAGGTATTGAGTAGATACT
TACTGGTTGCTGTCACATGTAAAGGATCAGTTAATGGATATGAAAAATTTTTAGGAGTAA
TACATTAAAACTGATAAAAGAAGTGGTAACAAGGTATGACATTTATTTGCATTTTGTTTT
TCCCAAGGAAATCTGAAATAGAGTATTACGCCATGTTGGCCAAAACTGGTGTCCATCACT
ACAGTGGCAATAATATTGAACTGGGCACAGCTTGTGGAAAATACTACAGAGTATGCACGC
TTTCTATCATTGATCCAGGTATGCTTTTCAAGTCAGAAAATCATTTTTTTCCTTTTTAAT
GTAATACAGATATTCCTTGCTATACAAGTGACTTTGATTCCTGAGTAAAAAGTATTTTAA
TAAAGCACCTAAGAAATAATGACTTGCTAATAGGTGAAGGGACTGGCAAGCAGGTGACAA
AACAGACAAGGAAAATTAGGTTGAGGGAAAAAGTACCTACAGCAGCGACATTCAGTTTCA
GGTTTAATGAATATTAGTTTAATGAATAGAGTCTACTGAGTACTTAATTCATATATTGTT
GCGAATATTCTCGCTGTTCTGGTTTTGCAATAATCAGGGCAGGCTAAACATTCGCTATAT
TAAAACCATGCATGTGTCCCCAGGCCTAGTTCTTTCCCTATGTCTGGTTTTATAAATGCT
GGTGATAAAATAGTTCTGACTGGTTAGTATGCTCATATGTGATGGCTCTAATTCTATGGG
ATCTTTGAGATAACAGTGCAGCCAGTACAGCTTTTACAAATAGTGGTAATTTGCAGACTT
CTACAGAAGCCATAACCAAAGTAGGGAGTTTTTGTGACTACTAGTAGCCACTAAGTGATT
TGTACAATTACTGTTTTTTGTTTTGTTTTGTTTTCTAGGCGATTCTGATATTATTAGAAG
CATGCCAGAACAGACTGGTGAAAAGTGAATCATGCAACTTTTTCTTTAATAAAACCTGCC
AGAGCTTGTTGGTAATCACTGTGTCCATGCCAGTTATTTTTTCTAGATCTTGTTTCAGGA
CAGTTTGCTAAGGTAGGGTTAGAGAGGGTGAGGCAGCTGGATGTAGACAAGACTTTGGGT
ACGAGGAGTTGCATATCCCAGTTTCCATTTATTTTCATTAGGGGTTCCTTTCTAATACTA
GACTTTGAAGAGAATTGATTTTCATAATTGTAGTCTTTTTTCTTTTTAAGATTTATTTTA
TTTATTTGAAAGTTACATAGAGAGGTAGAGCCAGAGAGAGAGGTCTTCCATTCGCTGGTT
CACTCCCCAAATGGCCACATCGACAAGAGCTGAGCTGATCCAAAGCCAGGAGCTTCTTCA
ACGTCTCTCACATGGTTGCAGGAGGCCAAGGCCCTGTGCCATCTTCTGCTTCCCCAGGCC
ACAGCAGGGAGCTCGATCGGAAGTGGAGCAGCCAGGACTTGAACTGGTGCCCGTATGGAG
TGCTGGCAGGTCTTTAACCCACTGTGCCACAATGCTAGCTTCTATAATTCTAGTCTTAGA
ACGTTGATTGCATTTTATATTTGAATGAGAGGCAACAATGTTAAATAACCAGAATTTAGT
TAAAATTTCAGTTTATCAAATCTAAATAGAAAAGATTAAGTAAAATGTTATTACAGGCTA
AAGAAATTCCATTGAAATTTAATGAATAAGGATCTTTTGACCACAAAAAAAGTCGTTAAA
GTAGATAATGTTCCAGACCTCTAGTTAAATGTTACATGTCAGATTGCTCAAATGGGTTTT
ACATTATATAATCCTGAGAGATGTAGCATGAAGTAAGCCTGTGTTCATGTCTTTGGAAAA
CTTCTATTTTCCCAGTGGGAAGTCCCATGGAGACTGGTAAAGGTAAATCTTAGAGTTGAA
TGGTCCAGGTAAGGGTATCTGTACCTGTTCAGTCTGCTAAGCTTTGAAGGAGGCTACTGA
AGGGTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1284..1429, 2647..2777, 3398..3447
1001..1021, 1284..1429, 2647..2777, 3398..3444
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved