Oryctolagus_cuniculus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus GNB2L1
Oryctolagus_cuniculus
GNB2L1
GeneScaffold_3703
SNORD96
1987..2065
6254
TTCGTGGCACCCTCAAGGGCCACAATGGCTGGGTTACCCAAATCGCTACCACCCCGCAG
TTCCCGGACATGATACTGTCCGCCTCTCGAGGTTAGTACCCGGTTGTGTGTGTCGCGGGG
TTAGACTGGGAACGTGTTATATGACGGATCATAGATCCCTCTGCGTGTTGGGGAGTGCGG
ACCCGAGTCTCTGTCTCATCCCGGGGGGCCCACGTTGCAGATAAGACCTGGAGGTGTTGT
CAGCTCGTGGCTGCCAGATTTGTTGGAGGTTGGCTGGCAGCTAAAGCTGAATGTGCCCAG
GAGCCTACAAGGCCGGGCGGGGCGGTGATGAGCCCAACATGCCATCTGAGTATCCATGCA
GAAATCCAGAGGCTGTTTCTGAGCTGCCGCCCGGCTCTTAGTTCGCTGGGTAGTGGGTGG
ACTGCAGGGAACCTTGTGGCTCAGATTTCCGATCTACATTTTCTTTCTGCGAATATCCAC
CCCATTTTCTCTCCATGTAGACCTTATCGAGTTTGGAGGCGTGTTCTTAACAGCTTAAAA
ATCGTCGAAAGTTAGGAATAATAATTAGAAATGGTCAGGAGCCCTCAGATACAATGGTAC
TTGTATCGGTTTGTAGGAGGAGAAATTTTAAGAGGGGGGCGCTAAAATGACTTAGTTAAT
TTTTCCACAGCTTTCTCAAGCATTCTGGCAAGATACAAAATATATGTTGAATTAGTTTGA
ATCTCAAGAAGGGGTAACCGTATTCTCTGACACCTGGGTTAGATTTTCGTGCTACAGTTT
AGGCCCACCTGCCTGTTTTTTGGAACTGTTGGCCACTGGGCCCTGGCAAATAACCTACAG
TTTGTTTCCTCTCGAAGTGTCTTTTTAAGTGTTAACCTACATATGATTTTGTAACATCTT
AAATTTTCAATAGGGTCAGCAAGTGGGCTGCAAAGTTCCTCACCAGTTTCCCTTTTGTCT
TTCTTTAGACAAGACCATCATCATGTGGAAGCTGACTAGGGATGAGACCAACTATGGCAT
CCCGCAGCGAGCTCTTCGGGGTCACTCCCACTTCGTTAGTGATGTGGTCATATCTTCAGA
TGGCCAGTTTGCCCTCTCAGGGTCCTGGGACGGAACCCTTCGCCTCTGGGATCTCACAAC
GCAAGTAGCTGCTCACCTAGCTGTGGGATCTTGGGGAAAAGCTGGGAAGAAATGAGGTAG
ATGGCAATTGGGAGGTTATCTTCCAGGAGAAAGTTGAAGTATAAAGTAAAAACTACCTAC
AGAAGATAGTTATTCGGGCCCCCTCTTAATTTTTTTTTTTCTAAGATTTATTTATTTGAG
AGAGTTAGAGACAGTGAGAGGGAGGGACAAAGAAAGGTCTTTCTTCCATTGGTTCAACCC
CCAAATGGCTGCAGTGGTCAGAGCTGCGCCTGTCCAAAGCCAGGAGCTTCTTCCTGGTCT
CCCATGTGGGTGCAGGGGTCCAAGCACTTGGACCATCTTCTGTGGCTTTCCCTGGCCACA
GCAAAGAGCTGGATTGCAAGAGGATACCCTGGGACTAGAACCAGTGCCCACATGGGATGC
TGGCAGTGTGTCACAGCACTGGCCCCTCAGGGGGCCCTTTGATTTAATTATGGTTGCTGA
GAAGTAGTCTGGTTGAATTTTTGAGAAAGGTGTTCCTTTTTCCATTGGTCACCCCCCAAG
TGGCCACTGCAGCTGGTGCACTGTGCCAATTGGAAGCCAGGAGCCAGGTGCTTCCTTCTG
GTCTCCCATGGGGGTGCAGGGCCCAAGGACCTGGGCCATCCTCCACTGCCTTCCCGGGCC
ACAGCAGAGAGCTGGACTGGAAGAGGAGCAACCAGGACAGAATGCAGCGCCCCAACCGCG
ACTAGAACCCGTGGCGCCAGCCTGGTTGAATGTTTTTATAGGTGTAGCAATTTGGAGTAG
ACAGCGGTTGGAACAAGTTTTATCTTGAATTTCTGTTCTAGATAAGCAGTTGGCAAGTAT
AATGGAGGATCCTGGTGATGACAGATGACATTGTCAGCCAATCCCCATGTGGGAGTGAGG
ACATGTCCTGCAATTCTGAAGGGATTCTCTGACATAAACTCGGAAAAGACTTGTTAGTGA
TGCAGTCCACCGGGATGGGGCGAATGCCAGAAAAATGTTGGTAAAGTTTGTCTAGAGTGA
CAGAGCTGTCTTTCTCAGGGCACCACCACAAGACGATTTGTAGGCCATACCCAAGGAATG
TTATTGAGGGTTTGCCTTCTTCCTCTTGATAACCGTCAGATTGTCCTCTGGATCTCGAGA
TAAAAACCATCAAAGTTATTGAAATACTTCTTGGAGTGTATGCAAAATACACTGTCCAAG
GTAAAAGTGAAGGGCAGCAAACAGCATGTTTCAAAGGTTCCCATGCACCCTTTCTTTTAA
CCTTTGCCTTATGTGTTGACTAAGAGAGATTCTGTTCTTCATGGTTCAGTTAGGAGATGT
GAACACAGTACTGCCAATATCCATTCCACCGAGATCAGGGATGGAGTTCTATAGTTTAAG
ATAGAAATGTTTTCTCTTACTTCCTTTCCATTCTCTGCAGGATGAGAGCCATTCAGAGTG
GGTATCTTGTGTCCGCTTCTCGCCCAACAGCAGCAATCCTATCATTGTCTCCTGTGGCTG
GGACAAGCTAGTCAAGGTGAGTTTTGAGCTGGCATAGAGGGCTTGTACAAGCCAGAACCC
CTTAGGCATTGTGGATTCCTTCAATTGACTTTTCCTCTTGTTGGATTTACTCAGTACAGA
CCATTGGTTTTTGACAGTTGGTCTTAAATAGCTAATTGATATCCCTTAAAAGCTTTTAAA
CAAGGTGCCAAGCCTTTTGCTGGGCTTGACTCTTCTCAGTCCTGGCTGATACGAGCTAAA
TTGTTCACCTGTAACCCCACCCATTTACACAGGTATGGAATCTGGCTAACTGCAAGCTGA
AGACTAACCATATTGGCCACACTGGCTATCTGAACACTGTGACAGTGTCTCCAGATGGAT
CCCTTTGTGCTTCTGGAGGCAAGGTATTTGGGGGCCAGGAGTCTCAACCAGGGGGACAGT
CTCATAGAAAGAATACCTTGGGGCCGGCGCCGTGGCTCAGTAAGCTAATCCTCCGCCTTG
TGGCCCCGGTCGGGGCTCGGGATTCTGTCCCAGTTGCCTCTTCCAGGCCAGCTCTCTGCT
CTGGCCCGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGGCCCTGCACCCCATGGGAGA
CCAGGAGAAGCACCTGGCTCCTGGCTTCAGATCAGCGCCATGCACTGGCCATTGGAGGGT
GAACCAACGGCAAAAGGAAGACCTTTCTGTCTGTTTCTCTCTCTCTCACTGTCCACTCTG
CCTGTCAAAAAAAAAAAAAAAAAAGAATACCTTGGGTCTTCGACATAAACTATAAACTAA
GTATTAGCCAGGTTATTCAAGAGTATGTTTCCAAAGGTCACTTACTGAAAATTACATGGG
TGAGACATACTGTTCAAAGGAAAAAAAAAAATATTTTCTCTGTAAAGTTTCTTGAAGCAA
TTGATGGATCCTGTTTGGAACTGATCATAGTGATTTTTTTGATAACCCATCAGAAAGTTT
ATGGGGCTATTGATGTCCTCTGTTAAAGGAAAAGCCTGTAGATATAAATATTGGTAGAGT
CAGTAGCTTTCAAGAAAGCCAGGGTACTGAAGGATCTGATGGGCAAGAGAGTTTTGTGGC
ACGGCCCATTAAGCTGCTGCTTTGAGATGCCCACATCTCATATTGGAGTACCTAGTTCAA
GTCTCAGCTACCTTCTGAGACACATCCTGGGAGGCAGCAGATAATGGTTCAAGTAGTTAC
ATCCCTGCCATCCATGTGGGAGCCCTGTCATGTTCCTGGCCTTTGGCCTGACCTAGCTAC
AATTGTTAGTAGTATTTGGGGAGTGAACCAGCAAATAGAAGATCTATCTATTCTCCTCTC
CATCATTCTGCCTTTCAGATGACTAAAATCTTTAAAAGCACATTGATGACAAAATCCTGA
GGTGGGTGGGATTGACATCTGGGAGAGGTTACATTGTGCTGCTGACTCACCTTCCCTATC
TGCAGGACGGGCAGGCCATGCTATGGGATCTCAATGAAGGCAAACACCTTTATACTTTGG
ATGGAGGAGACATCATCAATGCTCTGTGCTTTAGCCCCAACCGCTACTGGCTCTGTGCTG
CCACAGGCCCTAGCATCAAGATCTGGGTAAGCATGAGATCGAATCCTGGCAATGTGACTT
AACATGCCATATGGGTTTGATGCTGGGAGTCCCACATACTAAACAAATGCTAACCATCAA
GCTGTTGGTGGAGACCTAGAAAAGTTCCCTGGATTGGGATTATTAATGGAGGGGAATATT
TGCTTACTGAAAGGGGTGATTATGTATTGCAGAATACGCAGCCTCTGCATAATGGCTTTT
TGGTCTGTGTAATTGTGTAGTGGGTCTGTTTAGTGTTAGCATCCCTGACATCTATCCACA
AGATGTTGGTAACAGGCCATGTAACCTCTTCCATACCTAGTAGTTGCAACTGAAAATGCT
TGTAGGCAATGCCACATGTCCCCTTGGGCAAAATCATCCTGTTGAGACTCTATTTATAAA
AAGGGGCTTTTGAGAGGGGACCTCTGTTACTGAGTTTCTTAAAAAGTATCACTGGTATAA
ATGTATTAACAGTATCCTCACCCTGGTTTTGACCTATTTCTCAGGACTTAGAAGGCAAGA
TCATTGTAGATGAACTGAAGCAAGAAGTTATTAGTACCAGCAGCAAGGCAGAGCCACCCC
AGTGTACATCTTTGGCCTGGTCTGCTGATGGCCAGGTAAGTCTGACTTCTCACTTAACTC
ACCTTCCAACATTTCTTCTCTATACTGCTATTTTTGACATAAAGGAAAGTGATTTTTTTA
AAATGGCTTGGATGATCAAGAAAGAAATGTGGAATGCATGTTCCTTTCAACTGTGATGTG
GAGGTAGTGATTAGCCTTCATTTTTATGCACTGATACTAATTTGATCAGTTTTAAGATGA
TTGTATTCTTATCAACAGCTGTTTCTTCCTCTAAGAATAACAGCCACCAGCTACAGTCTG
GTCATTAGAATTAAGGTCCTTTAAAGAAAAGCCCTCTTTGTTGCAGTGGGACGAAGTTCA
CAACTCATCCTGTCATTTCTCCCTTGCAGACCCTGTTTGCTGGCTACACAGACAACCTGG
TGCGAGTGTGGCAGGTGACCATCGGCACCCGCTAAGCATTTTTGGCATGACTATGACAAT
AAATTGACTTTGACTTATGTAGCAATTGTGTTTTTCTGAGAAACAGAAATGTTCCATGTT
AGATTGGTTTGTCATTTCTCCAAAAGGTTTTTAAAAAATTTGAAAGGCAGAGTTAGAGAA
CAAGGTCTTGCATTCCACTAGTTCACTCTCCAGTAACCAGGTCCCAGGGGCTTTATCCAG
GTTTCCCACGTGGGTGCAGGGCCTCAAGGAATTTGGTCGTCTGCTGCTGCTTTCTCAGGC
ACATTAGTGATGTGCTGGATCGGAAATGGAGCATACAGGACACAAGCTGGTGACTCCAAT
CTGGACTCTTCAAGATTTCTTTGAAAGGTAGACAGGGATACCTCCTATTTGGTGTGGGTG
GCAAAATCAGTACTTAAGCCATCATCAGTTGCTTTCTCAGGTGAACCGCCAGGCAGAGTG
GTGGGGCCGGCGCTGTGGCACAGCGGGTTAATGCCCTTGCCTGAAGCACTGGCATCTCAT
GGACACCAGTTCTAGTCCTGGCTGCTGCTCTTCCAATCCAGCTCTCTGCTATGGCCTGAG
ATAGTAATGGAAGATGGCCCAAGTCTTTGGGCCCCTGCACCCACGTGGGAGACAGGAAGA
AGTTTATGGCTCCTGGTTTTGGATCTGCGCAGCTCCAGCTGCTGCAGCCATCTGGGGAGT
GAACCAGTGGATGGAAGACCTCTCTGTCTCTACCTTTCTCTGTAACTCTTTAAATAAATG
AAATAATTCTTAAGAAAAAAAGAACTGGAGTGGCACATGAACCAGCATTTTAATAAGGGG
TGCTGGCATTACTTTTTCTGTAAAGATTATTTGACTTAGCAGGTGGAAGAAAACCACTTC
TGAGTGTCTGCTCATTTGAAGGAATAAGACTCCACAAAAGAAGCAAATAAACATTTTATT
TCTGCAACACAAACAACCTTCCCTTTCCCCAAGAACATGAATTGACCTCAGCCTTCCAAG
CAGAGGACAAAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1143, 2177..2221, 2227..2244, 2246..2263, 2265..2280, 2282..2290, 2292..2302, 2307..2322, 2324..2338, 2560..2655, 2912..3022, 4085..4225, 4724..4834, 5189..5254
1001..1143, 2177..2221, 2227..2244, 2246..2263, 2265..2280, 2282..2290, 2292..2302, 2307..2322, 2324..2338, 2560..2655, 2912..3022, 4085..4225, 4724..4834, 5189..5251
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved