Oryctolagus_cuniculus Locus HSPA9B
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus HSPA9B
Oryctolagus_cuniculus
HSPA9B
GeneScaffold_2205
SNORD63
12993..13067
19138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTATGTGTTTTTTTTTTTTTTTTTTTTTTATTAAAAATAGAGAAGGGGA
AAAGGCTGTGGAGCGCTTGCTCGCTCTGAAAAATAACTAGCATCTCTTACATCTTAGGAA
ATGTATCTGTTCAGGGTGGGCGTGAAGGAGGGCTTGAAGGGGCCTGAGGGTAGGTCGTTA
CCAAGGTCGTTATCTTGATGGAAGCGCGCTAACGTTTTTGTTTAACTTTTTCGTGGCTCC
ACAAATTACTGATGCTATTTTCCTTAAGGCGATTGCGTGACAGAGTCGGGAAGTTACGCG
CTGCTACAGAGAGATTGAGAGCGATCCGAGCAGTGTGTAATGAATGCCCTGGTTCTTACT
CGGGGGCATTCTACCTCCTGGGGACATTTGGCAGTGTTTGTTGATATTTTGTGCTTTAGG
AGTCTGGGTTGCTGCTTACTGGCTTCCAGTGGGTACAGGCCAGGGATGCTGCAAAATATC
CTACAGAAGAGCCCCCGCCCAACAAAGAACTGGCTCAAGATTAGTGCTAAGGTTGAGAAA
TCCTGTATTTGTTTTACATGGAAGATTTTTATGTTTACTAAATATTTCCTATTTTAGTAC
CATAATAATGTATCTTAAACAGTCTGCAGTATTTCATTCCACTGTGGTTTTACACATGGT
AGCTGCTCAGCAGAGTGAAAATTGGAAACTTTTTCTTAGCATAATTGGAACGAACACTTA
TATAGTTGAGGGGTGATGCAGTTTTGTTTGTTCTTTTTTAGGATGGCTGGAATGGCTTTA
GTCATGAGGCGTTCAGAATCGTTTCAAGGCGGGATTATGCGTAAGTATACCATCATGTCC
TTTGAGAGAAAGCAGGGATTAATTTTATTTATTTGAAAGACAGAGTTATAGAGAGAGGTA
GAGACAGAGAGGTCTTCCATCCTCTGGTTCACCCCCAAGATGGCCGCAACGGCCAGCGCT
GAGCTGATCCGAAATCAGGAGCCAGGAGCTTACTCTGGGTCTCCCATGTAGGTGCAGGGG
CCCTAAGCTTGGGCCATCTTCCACTGCTTTCCCAGGCCAAAGCAGAGAGCTGGATCATAA
GAGGAGCAGCCAGTGCCCATATGGGATGCTGGCACTTTAGGCCAGGGCCCTAACCCACTG
CAGCTCTGACCCCTCTACATTTGTGATTAACCATTCCTCTCTAGTTACTTATCTGTAATT
GTATAGGTTATGTATTGTGCCCCCATTGACTCCTTTATTGAATCCATGTTTTCCTGTAGT
CATTTCAGAGACTACTGTTGATAATGACAACCATGGCATTGTTTTAAATACCTTGCAGAT
CAGAAGCAATTAAGGGTGCAGTTGTTGGAATTGATCTGGGTACTACAAACTCCTGTGTTG
CAGTTATGGAAGGTAAACAAGCAAAGGTGAGCATGATTGATAACTGCAGGTAACTTAAAG
ATATCTTGTCCCCCATACAAAGACCCTTTGATTTAATTAGGATTCTGAGACCTGGTTTGT
ATTTAGAAACTAAGATTTTTTTAAGGCTCTTGTAAAGTGCATTTTTATGGTACTGATTGT
TGAATGGATTTAACTTCCCAGACTAGGATTTTAATGCGTCATCTGGTGTGGGGATGAGAT
GAATTTATCATTAGGAGGAATTGGAACCGTTAGACTGTTGGTTAATCATGTAATCAAAGT
TCTGCATTTTTGTAAGTCATTTGAACCAAAGTTGGAGGATAAGACAGACTAGAAGCATGT
AGAGTTCTAAATCCTAAATAAAGCTTGTTTTTGAGAGCTCCCTGGTGTGGTAAAGACTAT
TCAGTCTTTACTCTGGGTATGAAACCTATTCACTTTAGGTTCTTAACAAAGATTTAGAAC
ACCTGGGATTTTTGAATTTTGCCTCTATTATTCATTTTCTGTGGCATCTCTCCCGCATGT
GCTTTTTTGAAACATCCTAAGCTGTCCAGGGACTTTTATTCCCACATTTTGGGCACTAAG
AGAAGGCGATTCCTTCCTACAATCTAATTTATGCTTTTTAGCACTTAAGTCCTATACACC
GGAAATGTATAGCCCTCGTGAAAGGAAAGTTTGAAAAGTAAGTAGAATTTATTTATGAAC
GGTATTACAAGTTCAAGTATTAAAATGCTGGTTTAGAGTCTCCGTTCCACTTCTGGTTTT
TAACTTTGTAAGTTGTTTCAAGGTAAAGGACTAAACGTATGAGATACCTTAAATATCTGC
TTTCCTAAGTATTAAGTATAAGTTAAGTATTGAGTATAAGCATTTACTGGGTCAGCATTC
ATAGCGGTAAGGCATGCCCACTGAAACTGTTACTTGAGTATTTATTTTGTGATTTGGGAC
CATTTTTTGTCTTAAAGTTTAAATTGCTGCAGTGATGTCACTGATGACTTAGAACATGAT
TCTCTTATTTGGGGAGTTTAGGTGCTGGAGAATGCCGAAGGTGCCAGGACCACCCCTTCC
GTTGTGGCCTTTACTGCAGATGGGTGAGCGTCTTGTTGGCATGCCAGCCCAAGCGACAGG
CTGTCACTAAACCCCGGACCAATACCATTTTATGCCACCAAACGTCTTATTGGCCGGCGC
TATGATGACCCTGAAGTACAGAAAGACATGTGAGTAATAGCAAAGGCACAGTTGGTTATA
GAGGCCGTATAGAAGAAGCTTTCAAGGTTGTTCAGGTTCTGTAGACACTTCACTTTGGTC
ATGTTACATACTGACATTGTCCCTAGGGAAAATCCATGCCTCGTGGGTAACTCTTTAAGA
GATTCATTTTTGCCTTCACAGATTAGGTCTTTTGTATATAAATATTGACATGATCTGTGA
AGGTTTGTGAAGCTTTCCTGAATTGGTGTTTAACACATGAAGCAAATAATGTCATAGATT
CTCTCATGTGTTGATTAGATATATGTACATTATATATGTATATACACGGAAGAAAAAAAC
TTTTTTCCTTCAGATTAAACATATTAGCAGTACATTTTTTATATTGCAATTTTTTGTTTT
TTGCTTTTTAAAAGATTTATATGAAAGCAGGGCAACAGAGGGAGAGAGCCCATCCCCTGG
TTCCTTTCCCTCAATGGCTACAACAGCCAGGTCTGGGCAAAGCCAGAGCCAGGAACTAGG
AATTCCATCTAGGTCTTCCACACAGGTGGCAGGAGCCCAAGGACCCGGCCCATCATTTTC
TGCCTTCCCAGGGCCCATTAGTAGGGAGCTGATTGGAAGTGGAGTAACTCAGGAGTCAGA
CCAGCACTCTGATATCGGATGCCAGCATTGTAATCAGTGGTCTAACATGCTGTGCCACAA
TGCCAGCCTTTAACACCTTCAGTCTGTTTTAAATGGTTTATTGGTTACAAATGGAGTCAT
ATAGAAGGGTACTTCGAAAGTTACTGAAAAAAATGAAATAAAAATATGAGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCATCGCAGGTTGTGGCTTTATCCACTATCACTGTGTCGGC
CTTCTCCAGTATGGCTATCTTAACCACTCTGCCAAATGCCTACCCCTCCATGAACTTTTA
AAAATATCACTGTAGGAGCTGGCGCTGTGGCGTGGCATATGAGGCTGCCACCTGCAGTGC
TGGCATCCCTTGTGGGTGCTGGTTCAAGTCCCGGCTGCCCCATTCCCGATCCAGCTCTCT
GCTATGGCCTGGGAAAGTGGTAGAGGATGGCCCAGGTCCTTGGGCCCCTGCACCCACATG
GGAAGACCCAGAGGAAACTCTTGACTCCTGGCTTTTTGGATCGGCGCAGCTCCAGCTGCT
GCAGCCAACTGGGGAATGAACTAGCAAATGGAAGGCTTCTTTCTCTGCCTCTCTTCTCCA
TGTTGCTCTGACTTACAAATAAATAAATATTTTTAAAAATATATCATTGTATATGTGGAC
TGCAGTGTGACTTGGTTGAATTAGCATATTGTCAAAGTTTATCCATGTTGTAGCATGTAT
TACTCTTGACCCTTTTTGTGGTCACTTTTTTGTGTGTTGATTTGTTAGTTGATGGGACAT
TTGGGATTTTACTTTTTGTTTATTAAAAATAATGCTGTCATAAGTGTGGTTTGTTTACCT
TAAAGTAGATTCCTAGTAGTGGAATTTCTGGGTCATGTTTCACCCTCAGCAGAGCTGCTA
GACCACTTCCAGAGCAGCTACTTGGTGAAGTAACGTTCGGCGTGCACTAGAATGATGTTT
TTACATGTTAAGGGTTGGTTTCCAGAGGTTTTCATGAGATTCATTTCTGGAGTTAACTTG
TTGGCCAGAGTCTCTTTAGAGGTTGGAAGGTGGATTTTTTTGGTGTGTGGTAACTTTATG
ATGGTAGGTGGCTCTGGTACATTTTCTCTCAAATGATTTTTTTATGTCTTTCAGTAAAAA
TGTTCCATTTAAAATAGTCCGTGCCTCCAATGGCGATGCCTGGGTTGAGGCTCATGGGAA
GCTCTATTCTCCAAGTCAAATAGGAGCATTTGTGTTGATGAAGATGAAGGAGACGGCAGG
TGAGCTTTTGTTGGGATCTGGGATAGTTCAGAGAACTAGGAGATCTGCGATCACTCACTT
CATGACCCCAGGGTTCTGTGGTACCCTTTGTACAGAAAATATAGAAGTGGGCAGACATAG
TTACTCTTTTATAATTCACTTTAAATCTACACAGCAGTGTACACAAAGTTGTTAAAGTAA
TTCCTTCCCAGTATAAACTCAGTTTTATAAAATTTATTTTAATATAGAATGAAATGGAAT
TTAGACACATTATTTAGCAAGTTAATTTTCATTATCTGTATTTAATATTTAGTCCATGTG
GGAAATAGATTTATACGTTGTAACGTTCTTGAAAATGGTAAAAAAAAATTCTGTATAGAA
AGAGTAAAGTTTTCTGAATGTTGTTCTTCATACGTTGCAGATTCTTCAGGTTTTCCTAAT
GTTGGATAGCTGCTTTTTTCCAGTAGTGGGCAATGAGGTGGTGGTGTGTGTGTGTGTGTG
TGTGTGTGTGTTACAATTTTTTTTTTTTTTTAAGTCAGAGTTATAGACAGATCTTCCCAT
CCTCTGGTTCACTCCCCAAATGGCTGCAATGGCTGGGGCTGGGCCAGACCAAAACCAGGA
GCTTCTTCTGGGTTTCCCACATGGGTATATGGGGTCCAAGCACTTGGCTATCTATTGCTG
GTTTCCTAGGTGCACTATCAGGGATCTGGATCAAAATGGAGCAGCTAGCTGAGACTCGAC
TGGTGACCATATAGGATGCCAGCATCACAAGTGGTGGCTTTACCTGCCACGCCACAGTGC
TGGCCCCAGGTAGTGCTCTTTTTTGAAAACCAGAAATCCACACATTAAGCTGTTGTCCCT
GTTAGGTAAAACTTAGAAATTTACATTTGAAGAAATTAGTGACTTTTAAATCTAAAGGTC
ATTGTAGCTTGGTGGACCTTCAGTAAAATATTGAAGGTGTCTTTAAAAATGGAGTGTTTT
GGGGCCGGCGCCGTGGCTCACTTGGTTAATCCACCACCTGCGGCGCCAGCATCCCATATG
GGCGCCAGGTTCTAGTCCCAGCTGCCCCTCTTGCAGTCGAGCTCTATGCTGTGGCCAGGG
AGGGCAGTGGAGGATGGCCCAGGTGCTTGGGCTCCTGCACCCGCATGGGAAACCAGGAAG
AAACACCTGACTGCTGGCTTCAGATTGGCGTAGCGCCGTCTGTGGCAGCTATTTGGGGAG
TGAACAAACGGAAGGAAGATCTTTCTCTCTCTCTTCTCTCTCTCTCTCTGTCTATAACTC
TGTCAAATAATAATAATAATAAATTGGAGTGTTTTCCTAAGAGGGTTCTGTATGTTAGGT
CACTTGGTCACTTGCCAGAAAACTAACTGATGAGTGTTGTCAGTGGCTCCAGAAGAGGAT
GATGGGGGTTAGGCTACATTAGTAATTGTTGCTATGATTGAATTTTGTTCTTGCCTTTTT
CATAGAAAACTACTTGGGACATGCGGCAAAGAATGCTGTAATCACAGTCCCAGCTTATTT
CAATGACTCACAGAGACAGGTGAGACCAATTAGTCATGTGTTTTTTTGTTGTTGTTGTTT
TGAAAGATCTATTTATCCATTTGAAAGAGTAACAGAGAGCACTTGCATCTTCTGGTCTAC
TCCCTGAAAGGCTGCATGCGCAGGGCTAGGGCAGTCCAAAGCCAGGAACCTAAAACTCCA
CTGGGGTCTCCCATGTGGGTGACAGGGTCCCAAGGACTCTGGCCATCCTCTGCTGCCCTC
TCTGGTGCATCAGAATGGAGCTGGATCAGAAGTGCAGCAGACAGCAGATTAACCATCTGC
ATCAACAGTGCCAGCCTCCTAAATAGTCTTACTCACAAAAAGTAGTGGTACCTGGGACAC
AAGGTGAGAAAATGCCTTTTGTTTTCTCTAGGCTACTAAGGATGCTGGTCAGATATCTGG
CCTAAATGTACTTCGGGTGATTAATGAACCCACAGCTGCTGCTCTGGCCTACGGTCTAGA
CAAATCTGAAGATAAAATGTAAGTTTGCAGTAAATGCCTCTTGGTTGTATAAAACTAAGG
TCATCGATATATGACATGCACCCTTTATAATCTTTTTTCTCTGTGACTGAGCCTCGTATT
CCAAGTAAAAATACTTCCTTTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TGACAGGCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTTG
GTTCACCCTCCAATGGCCGCCGCGGCCGGCGCACCGCGCTGATTCGATGGCAGGAGCCAG
GATCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCG
TCCACTGCACTCCCTGGCCACAGCCGATGAGGTGGCCTGGAAGAGGGGCAACCGGGACAG
AATCCGACGCCCCGACCGGGACTAGAACCCGGTGTGCCGGCGCCGCAAGGCGGAGGATTA
GCCTAGTGAGCCGCGGCGCCGGCCTACTTTTAAGGCTATATGGTCTATATTTTGTATTCA
TTTCAAGATCATTCCTTTGTTTACTTTTGGGTTGTGTCATTTTTCGTTGATACGTGTGCT
GACAACTAACCGAGCACCAAAAAGGGAACCTGTGGAAGTGAAATGGACCCTTTGAGAAGC
AGTGACTTGATCAGCCCTTGTCCTGAATGTTGATGAACAACTTAATAATACTTTTTCCCT
TTTTGTATTTTTTTGATCTACTTAATACTATTGGCTGAACTATTAACACACAATTATTCT
TAGGTGTTTAAATTTAACTGAAAAGTGATCCCTGTTAAATATGAAAGTGGGAATAAGAGG
GAGGAGATGTACAATTTGAGACATGCTCAATCTGATTTGCACCAAGTGGTAGAGTTAGAA
ACGTGCCAGGGGATTCCAATTCAGTCCCATCAAGGTGGAATATACCAATGCCATCTCACT
AGTCAAAGTGATCAGTTTCAGTTCACAGTTGATCATAATGATAGGATTAAGAGTCAAAGG
GATCACATAAACAAGACTAGTGTCTGCTAATACTAACTGATAGAATGAAAAAGGGAGAGA
ACGATCCAACATGGGAAGTGGGATACACAGCAGACTCATAGAATGGCAAATGTCCTGAAC
AGCACTCTGGCCTCAGAATCAGCCCTTAAGGCATTTGGATCCGGCTAAAAAGCCCGAGTG
CTTTAGGCATGGAAAGCGAAGACACTCTGACAAAAAAAAAAAAAAAAGACCTAAATGAAA
GATCTCTGCGAGTGAGATCCCAGTGTAAAGAACAGGCCATCAAAGAAGGAGGTACCTTTC
TCTGAAGGGAGGAGAAAACTTCCACTTTGACTGTGACCATGTCTGAATAAGATTGGAGTC
AGCGAACTCAAAAGGCTTCCATAGCCTTGACAACTCATGACAAGAGCCTAGGGTGATTAC
TGACGCCATGAACAAGAGTGTCAAATTGTTAAGTCAACAACAGGAGTCACTGTGCACTTA
CTCCCCATGTAGGATCTCTGTCATTAATGTGCTTTACACTTTGTATTTCTGTGTGGGTGC
AAACTCTTGAAATCTTTACTTAATATATACTAAACTGATCTTCTGTATATAAAGATAATT
GAAAATGAATCTTGATGTGAGTGGAATGGTAGAGGGAGCAGGAGGTGGGAGGGAAGTTAT
GGGAGGGGAAAAAGCCACTGTAATCCAAAAGCTGTATTTTGGAAATTTATATTTATTAAA
TAAAAGTTTAAAAAGATTTATTTATTAGAAAGGCAGAGGGAAGGAGCATTTGTCTAATGG
TTAACTTGCCTAACAGCTGTAGCAACTAAAACTGGGCCAAGCTGAAGCCAGGAGCCAGGA
ACTTTATCCGGGTCTCCTATGTAGTTGTCAGGGGCCCAAGTACTTGGGCCATCTTCCACT
GCTTTCCCAGGGAACTGAATTGGAAGTGGAGTTGCCAGGTCTCAAACCAGCACTCAAGGG
GATGCCAGCATCACAGACAGTGACTTAACCTGTTGTGCCACACACTGGCCTCCAAATGCC
ATTGGTTAGATTGATTTGTGGGTTTCATTTTAGCTGTGGAGTTTACATTTAACCTGTTAG
GGGCACATGTTAACTAGTCACCGATGGAGTTAACAGATTGTCTATTGCAATTCAGGGAAA
TGGCTAAGCTTGTCTTCATTTGGTTATTGAAATTTATGCTCTTGTGATAGGTTTTATTCC
TTAAGGTGCTCTTTTTCTTTTTAGCATTGCTGTGTATGATTTAGGTGGTGGAACTTTTGA
TATTTCCATCCTGGAAATTCAGAAAGGAGTATTTGAAGTGAAATCCACAAATGGGGACAC
TTTCTTAGGTGGTGAAGACTTTGACCAGGCCTTGTTACGACACATTGTGAAGGAGTTCAA
GAGGGAGGTCAGTTATTATGGTTAATATGTAGACATTGGGATAATTTATTTGTTCATGAT
TGCTTTTTTGCTTTAATAGAGCACTGAAATAATTACATTTCAGGTTCCTGGGTAGACTGA
ACTATTTAGTTACCATAACCTTCACATTGAGAGCAAACAGGAGACCTAAGTATAAGGCAG
TCAGTATGCCACTTTGGAAAAGGAATCTGGAGGACTTATTTTTGAACTGGAGTCCTAGGA
CTGGATTAGTTCAGGCCAATTTGCAGGCACCAATTCCCTTTCCAAAGTGGGGGGGAGGGT
GGTTGGTTGTTTCTCTACCTTTTAAAAGTTTTTATTTTATTTGAAAGAAACCGATCTTCT
GTCTGCTGGTTCAGTCCCCAAATGCCTGCAGTAGCTGGGGCTAAGCTAGGCTGAAGCTAA
GAACCTTGTGGGTGACAGAGATCCAAGCACTTGAGCCATTATCTGCTGCCTGCAAGGATT
AGCTGGAAGCTGGTTCATACTCTAATTGGCACTCTGAAATGGGATGTGGGGTTTGGTTTT
TGGTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAGACAGGTCTTCCTTTGCCTTTGG
TTCAACCTCCAATGGCCGACACGGCCGGCCCATAGCACCTGTCCGAAGGCAGGAACAGGT
GCTTATCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCAC
TCCCGGGCCACAGCAGAGAGCTGGCCTGGAAGGGGGGCAGCCGGGACAGAATCCGGTGCC
CTGACTGGGACTAGAACTCGGTGTGCCGGCGCCGCAAGGTGGAGGATTAGCCTAGTGAGC
CATGGCGCCGGCTGAATGTGGGGTTTTTTTAAGAGCAAAAGAAAGTGCTTCATGCTTTCC
TATTCTAATACTTGCAAATAAAATAATATTCATTACTTTGCTAATTCTGTTTCATGCCAT
CACTTTGTAGACAGGAGTTGATTTGACCAAAGACAACATGGCACTGCAGAGAGTGAGAGA
AGCTGCTGAGAAAGCCAAATGTGAGCTCTCCTCATCTGTGCAGGTGAGACATGGAATAAT
TCCAGTCTTTCTTCTTAGATTTATTCCCCATTTTTGGCAGCAGCAGAAAGAACAGAGCTG
TTGCCTTAGTTTATTAGCCACAGGAAAGAGGTATGTAAAGTGGTTGTGCTGATTAACCTG
CAGTCAAACCTGAGGTGTTTTAAAAGTAGCTGTGAGGAGTGATAAAGTTATACATGTATC
CATTTTGGGGGTTACTTTGCTCCTGCTTCATGTGAAGTTGCAGAATTTTGCAACATGGGA
TTGGCTTTGATACTGAAATTTGTGGGACAGCCAGAAGATAGCTTGTAATTCTTTGCTGGA
GTTGGATACTTTTGCTGGGGTGAGGTGTTGGAACAGATAGGTCCTTATATTAATAAATGT
CAAACCTGAAGTGATACAGAGTAAACAGTACTGCAGATTGCTTAGATTCTAGTCCCTACC
TCATATTTTTTTAAAAGATTTATTTATTTTATTTGAAAGGCAGAGAGAGAGAGAAAGGTC
TTCCTTCTGCTGATTCACTCCCCAGATGGTCACAATGACCGGAGCTGCATCAGTTTGGAG
CCAGGAGCTTCATCTGGTGCAGGGGTCCAAGGACTTGGGCCATCTTCTCCTAACTTATTA
ATGGAAGAAGTGGTTTAAAAGCCAATTATATTTATAATTACAGAAAAGAATGTGACAGAT
GTTTGACATAAGTAGAATAATTTCTGAGAGATGAAATTGACCTTGAAAAGATAAAAGGAA
AAGGGTGAAGACCTGAGAAAGGGCCATAGTGGATAAAGTGGGGCGGGCGTAGGCCAGCGT
GCCAAGTGAGTTACTGTGCTCTATAGAACTGAGATTTGTGAAAGAGGAGTACAAACACCA
GAAGAGTTTCCAAGTTGTTTGTATATTTGAAAGGCAGAGTGACAGAGATCCCATTTTTAC
TCTCCAAACGCCTGTGACAGCTGGGTCAGACCAGGGTGAAACCAGAAGACAGGTCTCCCA
CATGGGTGGCAGGAATCCAAGTACTAGGGCCATCATCTGTGCCTTCCCAGGTACATTATC
AGTAAGCTGTATTGGAAATGGGGCAACTGGGACTCAAACTGGCAAATGGATAATTTCAAA
GCAGCAATTTCACCTGCTGTACCACAGCTCCGGCCCTTGTATTGTAATTCTTAATGTTTA
GTGTGAAGAGGAATTTGAACTACTTGAGTACTCCATTTTTCATTGTTAATAGCTATAGAT
TTTATTTAAATGGTTTCTGTAGGGAGGTTGGAGGTTGCATCTTGCACAGTCACTGTCTTT
AGTAGCTGCTCAAATAAACCAGGTTTGATCATTGCTATGGCTTTTCAAGCCTGTCCTAGT
GTATGGTCTTAATTTTAAAATAATAAAATGTAACCACCATTTGTCTCACACTGAATGATA
AAACATTTCTTCTGCAGACCGACATCAACTTGCCATATCTTACAATGGATGCTTCCGGAC
CCAAGCATTTGAACATGAAGTTGACCCGGGCTCAATTTGAGGGAATTGTTGCAGATCTGA
TCAAGAGGACTATGGCTCCATGCCAGAAAGCTATGCAAGATGCAGAAGTTAGCAAGAGTG
ACATAGGAGAAGTGATTCTTGTTGGTGGCATGACTAGGATGCCCAAGGTATGGACCCATG
GAATTTTTGACATAGAAAAGAGGGTTACCCCATAAAACACTTCTGGGACAGGTGGCCTAT
TTTGCAGATGTAAGCATGTTGCTCTTTTTACCAGGGTGGCTTGAAAGAAGAATAAGATTG
TATCCTCACTTAAGGTTTCTGTTCTGCCTTTTTTTTTAGTTGGTATTAAAAAAAAAGTTT
AAGGTCTGAGATTGGAATGCTGGTCACAAGCCCTGAGGGTCTTTAGACATGTGTCTTTGT
ACACTGTGCCTTACTATCTCTTCAACAGATTTTGTGCAGTGATGCATTTTATTTAACAAC
ACATCATTCTGAACTCACAGATGTGTGGAGAACTAATGACTGAGCACAAACCTGTTGAAG
TCTGATCATAATTATCCTAGGCTGGAGTTAAGACCCTATATTTTTTATTTTTCCTTTGAA
ATATGTAGGCCTGGAAATATGCACAGGATAAACCTAAGAAAATTAAAGGCTCTGAGCTAG
AGCCTTTTACGTTAAGTTTTCCCAGGTACTATTTAAATACACTTTTTTTTAACCCTAATA
CGATAAACAGGAGGGATAACCATGTCATTGGTAACAGTATTGCATTATTTCTATGGCTTC
CTTTAATTGTGTAAAAGAGAACTTGGAGTATACTATATATATATACATATATGTCCCATT
TTACCATTTCAGATGATGAGTAAAGTACGTATTACTGGATCTTTAACAAGATCTGAGCTG
TGAACCAGTAATTTGAGTAAACATTGTTGGATCTGAATTAGCCTGCCTTGAGATTTCGTT
GAGGTCTTAACACATGCGTGCGCTCTCACTCTTCAGGCAGTTACCCTCGATGTTGGATAA
TAGATTCTTTCTTCTGTTGCCCAGGTCCAGCAGACTGTGCAGGATCTTTTTGGCCGAGCC
CCAAGTAAAGCTGTCAATCCTGATGAAGCTGTGGCTATTGGAGCTGCTATTCAAGGAGGC
GTATTGGCTGGTGATGTCACAGATGTGCTGCTCCTGGATGTCACTCCCCTGTCTCTGGGT
ATTGAGACTCTAGGAGGTGTCTTCACCAAGCTTATTAACAGGAACACCACTATTCCAACC
AAAAAGAGCCAGGTAAGAGCCACCCTTTCCTACCTTGTTATTTGAGGAGTGAACCAGTCC
CATAACTCCTAGCACCTTGACCTGCCAAAGCCATAATCCAGGACTCCCTAGTGGGTGGCA
GGGACCCAGCTACTTGAGCTACTGCCTGCTAACTCCCAGGAGCACATTAGCAAGAAGCTG
GAATCTGGAATGGAACAGGTGCTTGAATCCAGACACTCGCGTGGGATGTGGGTATTCCAA
ATTAACCACTAGGCCAAACACCAACCTTTGCAGCCACTTTTGTGAGCCTTTTTAGAAGAA
AAACTTGCTTTCTGTTTGTGGTCCAGACTGGTTGACTGAGGGTGGTGAGAACTTTTTGTT
TGGGAGAAGTTCATTATTTGTCAGCTAGCAGTGATTCTATAGGGAGGGCATCAGTAGCCT
CTCCTTCACAACATGAACGTAATTTGCTAAAAGGAGGCTCATAGTTTGGGACTGAATGTT
CTGTAGTCTTCTGTATTCGAGGACAGTAAAAAGCATACCCTGGCATAGACAAGGGGAGTA
TGCTTGTATGTGGGTAAATGAGGGTGGGGATCTCAGATACCAAGCAGGGCCATTTAGACA
TGGCTGGGCCTATCATAAATTATTATTTCCTCACTTTCCCAGTCTTTTTTTCTGAAGAAC
TGTGGCTGTTGCTGTATTTTTGTAGTGTTTTTCAACATGTCATCCTGAAGAAGTGTGTGG
TGGCTTCCTGAACTGAGTGCATACATCACCTGTTTCCCAGATAGCACGTTTCAGCATTTC
ACCACCTTGTCTTGAGCCCCTCTCTGCTAATGCTACAAAGCAGTAGCTATTGTCTGTCCT
TTTGCTGTACTAATCTTACTCTTCTTCCCTGTAAAGATGGGCATTTTTTTCTGAATATAG
TGTGTATTAGGATCCTTCCAATGTTGGGATGTGAATTTCTTTGTCTTGCTTGCCTTTTGT
CTGTATAAGGGGACTAGTTTAATCACATTGCCAACTCAGGAAATTTTCTTCTTGTAGGTG
TTTTCTACTGCTGCTGATGGGCAGACTCAAGTCGAGATTAAAGTATGTCAAGGGGAGAGA
GAGATGGCTGGAGATAACAAACTTCTTGGACAGTTCACTTTGGTACGTATTAATGAATCC
TGAATTGTGCTCAATTTCCTCATGTAAATGTAGGCTAACCCCTGAAAAGAATACTATAAA
CTGCTGAGGTACAGCATATCTTGAAAAGGTATGCAGACAGATTGTGGAACTAGATATGAC
TTCAGTTTTTACCTGAAAAACCTTGCTCTATTAAGTTTATAAAGAGCCAGAGAAAAGTTA
AAAAAACAACACTTAAATCAGAGAATTCCTGACTACTCACTTAAAAGACATTTGGTACTT
CTGATCAGCATTTCTTATTGGTTTTTGGTGCTACAAACAACAGAAGGGAAGTTTGCTGTC
ATTTACCATCGCTGAGTCCAGTATAGCCACTGTGACTACTTCGTGTAGTTGACCTTCTGT
GGTTATAACCCCTGATGATTTCAGGCACCAATGAAACTACTGCCCTCACTTAAAAACCTG
TGTTTATGTATATTAAGTGATGGTATCACTTGTTCTACCTAGGAACTAAGTAATTTGTTT
ACTAGAAAAGATTGCCTATTTGGAATTAGAAGATTGGACTCATGAGATGAGCTTATTCTG
AGTCTTTGTTTACTTATTTTAGATTGGAATTCCTCCAGCACCTCGAGGAGTCCCTCAGAT
TGAAGTTACATTTGATATTGATGCCAATGGGATTGTACATGTTTCTGCTAAAGATAAGGG
CACAGGACGTGAGCAGCAGAGTAAGTCCTTATTAATCAGACTCATAGTTGAGGGACCCCT
GTTGAGAAATAGAACCTGTTATTCACATCTTATTCTCCCAGACTCTGGGGAAGGATAATG
AGTCCATCCTTTCAGTCCCTTTTATACCTGTAGTGGTGTTTCAGTAGGCATGTAGGCCAC
ATGTTCTAAAGATAAGTTAGGTTTTTTTGTTTCCTTTTGCTTATTATTGGACATTAGGGA
ATTACTTTTTTTTTTTTTTTTTTTAAGATTTATTTGTATGATAATTACAAGTCATAGAAA
GGGAGAAACAGATCTTCCGTTAGCTGATTCACTCCCCAGATGGCTTGCAAAGGCCAGGAC
TGGGCCAAGCAAGAGCCAAGATCTCCATCCAGGTCTCCCACAAGAGTGGCAGGGGCCCAA
ACAACCTGGGTCATTCTGCATGGCTTCTCCCATCAGTAGGGAACTGGATCGGAAGTATAA
CAGCCAGGATGTGAACCTGTGCTCATATGGGATGCTGGCATGGCAGGTGGCAGCTTTACC
CACTTAAACCACAACACCTGCCTGAGTTACTCTTCATAATTTGCATCAAGATCAGCTATG
AGAAGACATACTCTTTCTTGAGGCAGTAGAGAACAAAGAGGTATATATTTTTTGTCTGGG
AATTAATGAGATGGCTTCTTTTTACTGTAGTTGTAATCCAGTCTTCAGGTGGATTAAGCA
AAGATGACATTGAAAATATGGTTAAAAATGCAGAAAAGTATGCTGAGGAAGACCGGCGAA
AGAAGGTGATAACTTTTTGCCTTTATTCTTAGTGCTTAATTTTAGCAAAGATAGGACATT
AAAATGGAAGACTAGACATGATACTGGGCATATTTCTGTTTAGCTTTTCCTTCTGTTTTG
ACTGTGATAACTTAAGGGTGGAATGGCCCCTCTGCCAGAAATTCTCATATTTAAGACTCC
AGCTCTCTCAAATCTATTCCAGATTACCTCAGACAATAATTATTTTTGCCTCTTAAGTGT
TTTTACCCTGTATGCAGTAGAAAGCTTATCTTGTTTAGAAAACTTTGGTTGATTAAACTT
TTAATTTCTCTAAGGAACGGGTTGAAGCAGTTAATATGGCTGAAGGAATCATTCATGACA
CAGAAACCAAGATGGAAGAATTCAAGGACCAGTTGCCTGCTGATGAGGTGATTTCTATCT
TAAAATAAGGAATAATGGAGGAAGCATTAACAGTGTCAGTGAAGTTCACTTTACTGTGGG
TCTTAATAGGGATTTAGCTTTATAAAAATGTATCTGGGGGCCGGCGCCGCAGCTCACTAG
GCTATTCCTCCACCTTGCGGCGCCGGCACACCGGGTTCTAGTCCTGGTTGGGGCGCCGGA
TTCTGTCCTGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGG
AGGATGGCCCAAGTCCTTGGACCCTGCACCCCATGGGAGACCAGGATAAGTACCTGGCTC
CTGTCAACAGATCAGCGCGGTGCGCCGGCCGCAGCGCACTGGCTGCGGTGACCATTGGAG
GGTGAACCAACGGCAAAGGAAGACCTGTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAA
AAAAAAAAATGTTTCTAGGGGCCGGCGCTGTGGCTCACTTGGCTAATCCTCCGCCTGCAG
CACCGGCATCCCATATGAGCACTGGGTTCTAGTCCCAGCTGCTCCTCTTCCAGTCCAGCT
CTCTGCTGTGGCCTGGGAGGGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCCTGCGCCCA
CATGGGAGACCGGGGAAGGCAACTGGCTCCTGCCTTCGGATCTGCGTAGCTCTGGCTGTG
GTGGCCATTTGCGGGGTGAACCAATGGAGGGAAGACCTTTCTCTCTGTCTCTCTCTAGAC
AAACTATTTGTCAAATAAATTAAAAAAAAAAATTAAAAATGTTTCTGATTACTGCTAGAT
GTGACATGACAGGAGACCTGGAAAAGCAAGAATTTTTGTTTTCTGTTTTTAAGTGCAACA
AGCTAAAAGAAGAGATTTCCAAAATGAGGGAGCTCCTGGCTCGAAAAGACAGCGAAACAG
GAGAAAACATTAGGCAGGCAGCATCTTCCCTTCAGCAGGCATCATTGAAGCTCTTCGAAA
TGGCATACAAAAAGGTACACACGCTGAAGGGTTGTTTGGATCCCTAGGTAATTGTAACTG
TTCTTGATTACTGTCACTTGTGGGTTCCTGCTCCTTTCATAGACATGTATGTAACTGAGA
GGGTGTGCTGAAATTGGAAATAGTCTCTTGCCTTCTTGACTCTAGTTTGGAAGTGAAGAT
AGTATCAGAAAAGGAATTGCAGGAACCACCAATAATGTATAAGAATATTTTTCATTTGCG
TACAACAGAAAACAAACTGTTAGCCCTGAAGTTAAGTGGTTCTCTAATATTCTCTCAACA
GATGGCATCCGAGCGAGAAGGCTCTGGGAGTTCTGGCACTGGGGAACAAAAGGAGGATCA
AAAGGAGGAGAAGCAGTAGTAACAGCAGTAAATTTTGAAGCTGAAAAGATGGCATATGAT
GAAGCTTGGGATTGAAGGGACTTCCTGAGCAGAAATGAGCAAACTTCAGTCTTTTTACTG
TGTTTTTGCAGTATTCTATATATAATTTCTTTAATATATAAATTTAGTGACCGTTATTAG
CAAATGATCGTTTAATGGGTGATAATTGCAACAGTATAGCATTCACTGTGTTTTGTCCTG
GCCTGTCACCATTTTTTAGCTGCATGTAAGAGAGGGCAGTACAATTTATTGATAACTATA
AAGACTTAACATGGCTTTGTGTGTTCAAGGGGTGAAACCATCTCACACACAACAATAAAG
ATAGTCAGCCAAAGATCTAGAACAAGACTGGGGATGAGATCTTTTTATGTTAGAAGTACT
GCTATACCGAATCTGTGTAAATGGGGTCCTTTAACTGAGGCCTTACTAGGCAAGCCAGTA
GCTGTGCCGTGTTTGTAAGTGGGTGGGACAGAAGAATGGAAAACTAAGCTAGCTACTTAA
ATAGCATCTAAAACAAGGTAGTAATGAGGCTCCCTAAATTTCCCTAAGGCATACTTTTCT
AGCTACCTATGGGTCTGTGTCCTGCCACCTCCATCCCTGAGGTTGTTCTTTGGATCCAAC
TTTTTTTTTTTTTTTTTTTAATAAATATGAAACACATTCTTATCTCTTGTTTTTTAGAAT
TGAGGCTCTGTGATTGAGCTTTAAGGATATGACATGACTCGTTTTCTCAATGGAGGAAAC
AAGATTTTCTAATGCTGAGTATCAACATGGGCAGAACTGGTTTCCCAGTTTTAAATTGTG
AATCTTGAAACACCATCTAACGTAGGGCTACTATTTTCGGGTTACCTCTAACCACCAAAA
AGTCCAAACAGAACTGGCTTACATCAAAGAAACTGCTAACCAATAGTTAGTTTGAAGTTA
AGGTTTTAGTGTCTCCAAAATAATAGGTTCCTTCCCTATTTCTTTCCCATTTTGAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1558..1645, 2661..2722, 2724..2748, 2750..2784, 2786..2848, 5514..5638, 7085..7158, 7531..7637, 9864..10026, 10990..11082, 12497..12706, 13584..13811, 14817..14921, 15502..15619, 16290..16384, 16694..16786, 17633..17773, 18061..18138
1001..1059, 1558..1645, 2661..2722, 2724..2748, 2750..2784, 2786..2848, 5514..5638, 7085..7158, 7531..7637, 9864..10026, 10990..11082, 12497..12706, 13584..13811, 14817..14921, 15502..15619, 16290..16384, 16694..16786, 17633..17773, 18061..18135
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved