Oryctolagus_cuniculus Locus MAGED2
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus MAGED2
Oryctolagus_cuniculus
MAGED2
GeneScaffold_1173
SNORA11
6106..6234
8366
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGCGTGTGTTGGGGTAGGGTGCCGGACTGCGACGGTGACCATTACGCAT
GCGCACTAAGTATCGCTAGAAAGGGGCGTGTTGAGCAGGGCCAGCGCTCTACGGGGCTCG
CTGCCGAATGCGCATGTGCACGGTGGACATCAAAGAAAGGGCTTGTGCTGGGAAAGAGGG
CGGGGCTGAGATGGGCCCTGCAGCAGACGCGCATGCGCACTGTCGGCCTGCGGCTGGGGG
GGGTGCACTGGGAAAAGGGGCGGGGTCCTCAGAGCTGCCGCGCTGGCACATCTTCCTGGA
GAAGGGGAGGGTGCGGCTGCAGAGAATTGAGACCTAGACGCTCTGGATTCCTGTATCTGA
GAACGGAGTTGTTGGAGTTGGGGGAGGGCTTGGGATTAGGGCTTTAGGGAAGGCGAGGCT
CAGCCTCTAGGCAGATCGGGGGAGAGGACGTTCAGTGAGCTCTCCACTTGACCCAGGCCT
TTTCCCCTTCAGGCTCAGCTTTTGCCAGGCCAGCTTGAGACATGTCTGACACAAGCGAGA
GTGGTTCGGGTCTAACTCGCTTCCAGGTAAGGTCTCTTTCTGTCCTCTCCCCAGCTGTTT
TTCCTTTCCAGTCCCTACTGCTGCTCCAAGTCCCTTGGCACTTCCCCTCCCATCCTTGCC
CTTCCCCACCCACTTTCCCTGCCTGAGCGCTCCCTCTCTCAGTGGAGGGAGAGAGGAAGA
GAAGCTGGCTGGGGCAGGGGGTGGGGTGGTGGCAGGCAGGAGGGCATAGGCCCCTCTTCT
GCCATCAGTTCTTGGCTCAGAGGAAAAGGGGGGGGTCTTGTTAGGCAGAGGTGGTTGGAG
CGCATTGTGGGTAGGAGTGAGTACACAGTGCAGGTCAGAGAAGTATGGCCTTGGAAATTT
GGAACCTTTTGTCTAGTTGGGGATGTGGAGAAGGTCTGTGAACTTCGCTGCTTCCTCTTT
GCAGGCTGAAGCTTCAGAAAAGGACAGTGGCTCAATGATGCAGACCCTGTTGACAGTGAC
CCAGAACTTGGAGGTCTCAGATACACCAAAGGCCTCAAAAGCACCAAAGGTCTCAGAGGT
TGTGAAGGTCTCAAAAGCCCCAGGGGGCTCAAAGGCCACGGAGGTCTCAAAGGCCCCAGA
GGCTCAGGAGGCAGCTGCTACCCAGGGCTCGTCGACTGCTCAGCTGACGGATACACAGGT
TGTGGCAGCTGAAAGCAAGAGTCCAGCAGCTGACAGCAAGACACAGAATGCTGACCCGCA
GGCTGTGACAATGCCTGCTGCTGAGACCAAAAAGGTCAGCTGTGTGGCTGAGAAGAAGGT
CAAGGCAAAGGCCTCGGAGAGTGAGACTCCTGCTTCTCAGGCTCCAGCAGAAGAACGGGA
GCCTGAGGGTGCAGCTGCTCCAACTCAGGAGAACCAGGATACTCGGCCCAAGGTTAAGGC
CAAGAAAGCCCGAAAGGTAAGAACTCTGCAGTCACCACTCTTGCTTTTCCGTTCCTCTTC
TCTCACGGGGTTCACTTGTTCTGTAAACATTTAGGAACTTCCTCTGCTCATCAAGGCTGT
GGGGGGACATGGAGAAGAATGTGATGTGATTGGTGTCTTTAGAGAGCTCGCTGGTGGTAG
GGCAATGAGACAGGAATATACATGGCTGCAGTCTGAATGGAACACAGTTTGTATTTATAT
AGTAGCTGCCAGCTGTTGGTACATTCACTCAGGGCATGTCATTAAATGTTGAACGCACAC
TTAGAACCCCAGTTTTCTAGAGAAAGAAGCTGAATCCCTGAGAGGTAACTTGTCTAGGGT
ACTACAAGCCGAGACAGTGGTTCACACAGAAGGGGAATCCTCAGGCCACACCTTTGGGTT
GCTCCTGGCCTGCTGGGGAGATGAAATTCCTGCATGATAGTCAGGAACAAACAAACCCAG
GACTCAGCATGACCAGTGAGTCAGGCTGGGACTACGGGAATGGGAATAGGGGGTGCTTCC
TGCAAGAGATAGGGTGAGGGAAAAAAATGACCACCTGCTTCCTCTGGTGACACTGAGCTG
CCTCTGTGTTGATGCAGGTGAAGCATCTCGATGGAGAAGAGGATGGCAACAGTGATCAGA
GTCAGGCTTCTGGAGCCACAGCTGGCCGAAGAGTCTCAAAGGCTCTGATGGCCTCAATGG
CCCGCAGGGCTTCAAGGGGGCCAATAGCCTTTTGGGCCCGTAGGGCATCACGGACTCGGC
TGGCTGCTTGGGCCCGGAGAGCCTTGCTCTCCCTGAGGTCCCCTAAAGCCCGTAGGGGCA
AGGCTCGCCGTAGAGCTGCCAAGCTCCAGTCATCCCAAGAGCCTGAAGCGCCACCACCTC
GGGATGTGGCCCTTTTGCAGGGCAGGGTAAGAATTCTGTCCTTTGCACTCTGCCTTGTCC
GCTGCCTTGCCTTGTCCTCTTGTCTGCCATCTTCTCACTTTGTGCAAGCTTCTTTTGACA
TTCCTTTTTTCCCTTCTCTCCCAGGCAAATGATTTGGTGAAGTACCTGTTGGCTAAAGAC
CAGACAAAGATTCCAATCAAACGCTCAGGTAGAGTCCTACTGATAACCCACCTGCCCTGA
GCTTTACCCTCCGTTACCCTCTCCCTCATATAACTGGGTACTCCTTGCTCTTATGTCCTT
ATCTCTGTCTTCCCAAAGTTCTCACTTGGCAGTGCTAGCATCTCTATTGATAAGCTCACA
AGCTGGCTACGCCGCTCATGGCATGGTTGGAAAAAGTTTTATGGCTTGGGCATTGGGGGA
GTGTGTATCTGGTGTCTTGTTAAGCCCAGGTGCTTGCAACCCTCTCCTGTTGCAGACATG
CTGAAGGACGTCATCAAAGAATACACTGATGTGTACCCGGAAATCATCGAGCGAGCAGGC
TATTCCTTGGAGAAGGTAACGGGCAGCCCTGGGGCATGGGCGCAGTGGGAAGCCTTGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATGCTTTATGTGCGTTATCTCACCGATTTATCACACACACACAACCCTTAGGTA
CCCAGGGAAGCTGCATGATGCCCAGGAAGCTGAATTTTGTGATCTCACAGGCTGTTCTCC
CCATCCACAGGTATTTGGGATTCAGTTGAAGGAAATTGATAAGAATGACCACTTGTACAT
TCTTCTCAGCACCTTAGAGCCCACCGATGCAGGCATACTGGGAACGTAAGCTGGGACAGG
GCTCGGGTGGGAGCGGGGTTCTGCTTTTGTCTGTGGCACCACCCCTTCCTTCCCTGTCAT
CTCTCCCCACATTCTCTTAGAGAGCCGGGAAAGCCCCTGTCACAGCTCCCGCATGTAGTT
TAAGCTCCACCTGCAGTAGTGGTACAGGATTGTGATTGACGAGTGTAGGAGCCTGAGGTG
GGGGCATTGTTGCTGCCAGGTGTGCTGTTTTTCCAGAAACTTCCAGGAAAGGAGGCCTGT
CACTTCCTACTTCCTACTGAGTAACTGGCCTGGCCCTGGTAGAATGACTGTAAAAGGAGG
GTTCCTTGACGTGAGTGGATCACGATGCTCGAAGGCCGTTAGTGTCAGCAGGGCTCTGCC
TAGAAATCTCTGAGGGCTAAGGGAGAGAGAAAAGGAGCCACAATTGACTGCGTGTCTGTG
CTGTACCAGGCTGACAGGCATTCATCCATCTTCTTGGTAACCTGGGGAGGAGAGGGTGTG
ATTTTCTCATTTCACTGTATTGGAGTCTGTGGTCCATGAATCTTAAGTACCGTGCCCAGG
GTCACATAGAGCTTGAAGCCTGGACAGGACAGAATTCTGCCATATCCAGGGAAGCTGTGA
GAGGCTCACCTGATGTGACTTGCAGATGGCTCCTGCACATAAACTTTTCTCTGTCCATTA
TTCCCTTAGGACCAAGGACTCACCCAAGCTGGGCCTTCTCATGGTGCTGCTTAGCATCAT
CTTCATGAATGGAAATCGATCCAGTGAGGGTGAGTGGCGGGGCACGCAGCTGAACGGGTG
GCTGGGGTCTGAATTCCGTGTGTTCATTTTCGGCCCTGTCTCCTCTTGCCTCCCCCTGCA
GCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTATGATTGGGCTCTC
TCAGCGCTTGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGACGGTCCCAGGATTGCATCTG
CCTGGTGGTCTGGTGGCGCGGGTGGGGGGTGATGGGCTGGGTAGAGGGTCTGGGTTCTGA
CCCGGGTGGTTGGGTGAGTGGCCGTGAACTATTTGCTCCCTCTCACTCTCTCTTCAGTTT
CGATGGAGATCCCTCTGTGCTGAAAATCTTCTTCATATTGGAAACACCTCTGACCACATC
TGAGAAGTGCCACAGCCCTAACTGTCTTTATTTATTTATTTTCATTTTTCTGTTCTCAGG
ATACATCACTCACTCTTTGGGGATGTGAAAAAGCTCATTACTGATGAGTTTGTGAAGCAG
AAGTAAGTGTCTTTCTGGTGTTGGTGTGGTCCATGCATTTTATCTGTTTCAGAACTGAGT
AATACAACCATGGTGTGTGTCAGTGTGTGCGTGCATGCGTGCATGCAGCTGGTGGGTTAT
TTCTGGAGCAGTGAACATAGAACAGGAGTAACACGCATTTCCTAATCTATTACTCTGTGT
ACTCTCACATTTGTCTCTCCAAGGGAGAGATTATCATCACTAGCATTGTCCATGGCAGAA
ACCGATTCTCAGAGGGGCAATGCCATTTGCTTAGGGTTACACAGGTAGCAGATGAAAGAA
TGGTGTTTAGGACTTGGCTCCACAGGCTTGCTTCATTTCACTGTGCTATCCAGGGCATCT
TAGACATTAATTCTCATAAAGAAATGCCATAAAATGGTGTCTTTACGTAGCCAGGTACCA
GGCTGGGGGGTGTAACTTGTATATCTCATTTCATTTTCTTACTGCCCTGCAAAACAGGTG
TGGTTATCCCATCCCTGTTTTGTACTCGCAGAACGTGGGACTCCAAGAGGGGAATTCTAA
GTATGGCCCACAGCTGCTAAGGGGCTTGTTTGGGCCTGGAGAGCAGTCCTCCTGACTTTC
TGGTGAGAACCTGCCATGTCATTGGCCTTTGAAGAATGTGCAAGCACACACATAGGCACT
CAGAGCCACCTGAGCACACAGGAACACAGGCACACTCACACACAGGGTCAGGAATTTAGG
ACTATGCCTGCAGCATTCTGATCATGGCTATCTCTTCCTTTACCATCTTTTTCTGTGGTG
GACCTCTCCAGGGTTTAGCCAGATTGCAGATAAGAACCCTTAGGGTGGGGTGTGCTCAGA
GCAAGGGGCCTGAAGAATGGCTCCTCTGTTTACAACACACCCAACAGGAATCTTGGGTCA
TTGTGATGAGGTCCATAAAACTTGTGGCCTCTTTACAAACTAATGCCCTACACATGTGCC
CTGTGCACCTTCATGTGGCTATCAGGCAAGACCAGTGGCACGAGGCTCAATGTTGGAAGA
AAAGTTGCAGTGTTCAGTGGAGCACATCACCACATAAAGTCTCTCTAGTCTTTGCCTTGG
TGGGCCCTGGGTTGTCTTAGAAATAAAGGTTTTCAACTTCTCTTTTCTAGGTACCTGGAC
TATGCCAGAGTCCCCAATAGCAATCCCCCTGAGTATGAGTTCTTTTGGGGCCTGCGCTCC
TACTATGAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTGCAAGGTAATTGGAGAGCTA
CCTAAACTTGGCATATTGAGAGCATGGTGTGCCCTTGGATGGGGCCAGCTATGTGCAGAG
CAGCCTGTAGTTCATATCTCAGCGATCAGAAGCGTCTGTTAATTGCCAAACACCATGCCG
GGCACTTTTATCTGAATTATTTAACCTGTACAAGTAGTATGTCATTGCCGTGTTGCAGAT
GAGAAAACGGAGACTCAGAGAGGTTAGTAGGTGACATGTTCAAGGTCATAAAGCTAATAA
GTATCAGAGCAAGGATGGACTATTAGGTACATAGTTGGTAGTAGTACTTAACTGTATTCA
TAATATTAAATACAGCCTATAGCTTGGTGCCTTATTTAGGTGCTCTCTAAATATGACCCT
TCTTGTGGCTGTTGTTTCAGGTACAAAAGAAGGATCCCAAGGAATGGGCAGCTCAGTACC
GAGAGGCAATGGAAGCAGATTTGAAGGCTGCAGCTGAGGCTGCAGCTGAAGCCAAGGCGA
GGGCTGAGATTAGAGCTCGAATGGGCATTGGGCTTGGCTCTGAGAATGCTGCTGGGCCCT
GCAACTGGGATGAAGCTGATATTGGACCCTGGGCCAAAGCCCGGATCCAGGCAGGAGCTG
AAGCTAAAGCCAAAGCCCAAGAGAGTGGTGGTGCCAGTGCCAGTGCCAGTACCAGTACCA
GTACCAGTGCCAGTACCAGTACTGGTGCCAGTGCCAGTGCCAGCAGTGGCTTCAGTGCCA
GTGCCAGCCTGACTGCCACTCTCACGTTTGGGCTCTTTGCTGGCCTTGGCGGTGCTGGTG
CCAGCACCAGTGGCAGCTCTGGTGCCTGTGGTTTCTCCTACAAGTGAGATTTCAGGTATC
TGCCTTGGTTGTGGTGGGGCTAGCTGGGGCCCACAGGGATGGGGTGTGGAGCTGGGCTGC
TGCTGGAAGGCCTGGGTTGGAGAAGGCAGTGGAGGGTGTGCAAAGACACTGTTGGCATTG
GCATTTTATTCGTTCGTGTTTGGTGGATATTACCTGACTTTTTTGATTTTCTTTTACTTG
TGTTTTCAGATATTGTTAATCCCAGCAGTCTTTTTCCTCAAGCCAGGGTGCATCCTCAGA
AACTTACTCAAGATAGCACTCTTGGCAGCCACTATCAATCAATTGAAGTTGACACTCTGC
ATTAAATCTATTTGCCATTTCTGAGTTTCTTGCTTTTTTTTTTTGGTGGGCTGTCAGTTT
GGCATCACATTTAAAAAGGAATACGGGATATTTCCACCTCAATCTATGTTTATTTTGATA
ATACTGTTGGATCCCCAGGAGTGAGATTACCCTATTACTCTGGGCTAGGTTGAGCCCCAT
CTCTAGCCAATAAGGCAAGGTGGGATTTCAGTGGGGGGTGCAGACAGTGGATTGGAGGCA
CCAAGGACACCAATTCGAAAAAGAGGTTTGGATGGACAAGTTTGAGCAGGAAGCAGAGGG
AGAAGAGACTGGAAATGACATGTTGACTCTCCTTTTGAGAAATCTGGGTGAGACAGGAGA
GAAAGAGGCAGGTAGACAAAAGGGAGATAAAAGAACAAGGGAACATTTTCTTGGGGAAGG
AGAAATGAGCAGAGCAAGAGCCAGTGGAGAGGAAGACGTTGAATGGGTTCTGGGATGGGG
ATGGGACCTGGGAAAGTCCAGACAGGACTCTGACAGGAGACTGTGGAAGGATGTTGAACA
ATGGGGAAGCACCCATAGGACATGGTGCCCATGATTTGAGGGGGAATATAGCAAGATGCT
CTGTAATCTTGGTGCAGGGACTGAGAAGCAGAGCAGTGTCGGCTTATTCCCAGTTTTGAG
TTTTGGTGTTTGGATCAGAATAAAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1444..1935, 2537..2845, 2964..3027, 3295..3374, 3910..4004, 4689..4768, 4861..4903, 5219..5281, 6410..6524, 6920..7366
1001..1045, 1444..1935, 2537..2845, 2964..3027, 3295..3374, 3910..4004, 4689..4768, 4861..4903, 5219..5281, 6410..6524, 6920..7363
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved