Oryctolagus_cuniculus Locus RPL4
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RPL4
Oryctolagus_cuniculus
RPL4
GeneScaffold_5239
SNORD16, SNORD18, SNORD18
10180..10278, 10606..10677, 11471..11537
13500
AAATAACTGGTAGTTATTTAGGCCCCGGTGGGTCCGACGTTTAGATAGGACGAAGCACT
GCGCGCGGCCCGCCCCGGAGCGGACGGGTGAGGAGCCCCGACACGGAGCGTTCCGTCTCC
GGGGTGCCTCTGCTTCTCCGTCACAGGTGGGAGCACCTGCGGCCGGGTCGGGGGCTTCCG
TGGAAGGCTCGTCAATTCCCACCTGGCTAGATAACGCACAGGCTCTTGTCCCCAAAACGC
CCCCCAGCCCCCTCCCCGGGCCCGTCCCGCCCCCCCCCGCCGCCTCCCGCGCCCCGGGAC
GCCGGAGAAGCGAGCGCCCCAGGGCGGCAGGCGGCTCTACGCGGGCAGCCGGGTCCCCTG
GGGCGGGAGAGCCGTCCCCAGACCCCGGCCGACGCGGGGGACCACGACTCACTGCAGCAG
GCCAGCGTAGAAATCCGCCGCCGCCCGGTTGACTCGCGCCCACATCCCGCCCCGGTCCGA
CTCGAACTGCGCGCCCGCCGCCGACGTCAGGGGTCACAGCCCCGCCCCGCCGGGACTACT
TTTACGCTCCACGAGTTCCGTTTTCCGCAAAGTTAAATTTTTATTTCGCAGCACCAAAAT
ACGCGTCTTTTCTTAACCACAGCTCTTTCAGTCCTGTTCTGGAAAAAAATAAATAAATAA
AATAAAAATAAGTGTAGGGGTTACGGGAGAAGACACCGCGTCTCGCGAGACTTGGCCACG
CCCCTTGAGGATTACTCCGCGCAAAAGAGTCCCTTCAATCTGAACACTATTATTAATTTT
GAAAGACAATATCTACGTAACCTGAGCCACATGAATAAACAATACGGTGCTTCTGATTTC
TACAGTGTGGTATAGGGAGGTTTTGTTCCTCCGCGTGGGTTCTTAGGCGGGCTAGGTGGG
GGACGAGTTGAAGGGTACATAGAGCGCGGGAGTGATAGGTCCTTCCTTTTCCTGTGGGAG
CCGCCGGGAGGAGAGGAGCGTGGCTCTCACCTCTCCCCGCCATGGTGAGTGGAAGTCGTC
CGGGCCCGACTGTCCTCTCGTGTGGGGTGCTAGTCGGGGAGGACTAGGGGTTCGGGCCAT
AAAGCTTGCGAGGGAGGAAGAGCAAAGGCGATGAGGGCCGAGCGCGTCTGTTTCCTGCCG
AGCAGCCGGGTTGTATGGAGACCCGGCAGCCATCTTAAGGGCAACGTGGGCGGCCCGGCT
CAGGCGCGCCGGTCGTTCTCGGGCGCCTTGGATGTTGGGAAACGGGTTCTGCGGGGATCG
GGAGGTCCCTGGGCCTGAGACCCAAAGGGGCCGAGGAGGGTCGGTGTGCGGTCTCTCACG
CGACGTGAGAGGTTCTTACCTTCGGGGCTTTGTTAAACGGAGGAGGACACCTGTTTTTTA
CTTCCCTGCCCGGCCTAGGAGCCATTCCTCTAAAAGCCGTGGGGTCCGTGTGTGTGCGCG
GCTGGGGTAAGGCAGTGGAGCAGTGACAGCGCTGTCCTTAGGGCGATTGAGTGAACGAGG
TCGGAAGTGTTCGGGGTGCCCTAGCGCCGAATCTTACTTGGATACAATTTCCGAGCGGCT
TCCCGGGGAGGTGTGCTTGCTGTGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGAC
AGTTGCCTGCTGTCAGCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTTCTTCGCTCTTTTAGGTCACCAGACCAGTGCTGATTCGTGGGGTACTGGCA
GAGCTGTGGCGCGAATTCCCAGAGTGCGAGGTGGCGGGACGCACCGATCCGGCCAGGGTG
CCTTTGGGAATGTATCCTTTGTTTGCCTGCCTGCACCAGTCCCTCTCGGGGAAGGCAGCT
GACCGGACCTGGTCGGCTTATACAGCACAGAAATACTCTGTTAGACGCCGCTCTTTGATG
TAGAAAGGGCCTCCCAGGGCCTCGTGTGGCGCTGTGCGCTTGCCGTGATGTCGTAATTTG
CGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCAGTGTGCTGGTTCAGAAGGTTGA
CGAAAATGCTAACTGAGCAAGACAGCCTTTTTCTAAAATGACTAAAATTTGAAAAAAGTA
ATTCTTCACTGAGAAACTAGATGTGCCGAGGAGGCCGCATGTTCGCACCAACCAAAACCT
GGCGCCGTTGGCACCGGCGAGTGAACACGACCCAGAAGCGGTACGCCATCTGCTCTGCCC
TGGCTGCGTCGGCCTTGCCAGCGCTGGTCATGTCTAAAGGTCTGTGGCATTTTTGGGTCC
TAACTGCCTGTGTGAAATGTTCCTTACTAAGCGCTGCACTGTGTCAGTCCAGCAGGTCTG
TGTCAGTAGTACACTCTGGACTTCTGTCACGCTCCCCTCGCAGCTGTCAAAATGATGAGA
TTCCACTTCATTGGTCCGTGTTTCTGAAACACATGATAATTGTGGGAATTCTGATGCAGC
AGATTGTATCCCGTTTTCCTCTGGGTCATCCATGTGTGATTTTCAGGGGGCACAGGGTAG
CCAGATAACACAGAATTGGCTTTGGCAGGTCATCGTATTGAGGAAGTGCCGGAGCTTCCT
CTGGTGGTCGAAGATAAGGTTGAAGGCTACAAGAAGACCAAGGAGGCAGTTCTGCTGCTT
AAGAAACTCAAGGCCTGGAATGACATCAAGAAGGTAGCTTTCAAAAGCACATGTCGGTTT
CCATACCAACTATCAAAAGGTAGTTGTAGAAGGCAGCAGTCACCACCCCGTATGTGTAGA
GGTTTGGTTTTGTTAGATTGATTTATTCGAAAGGCAGAGGAGGAGAGAGGTATTCCATCT
GTTGGTTCACTCCCCAGAAGGCCACAATGGCCGGAGCTGTGCTGATCTGAATCCAGGAGC
TCCCATGTGGGTGCAGGGGCTCAAGAACTTGGGCCATTTTCCATTGCTTTTCCTAGGCCA
TAGCATTTGGGAGAGCAAGGACGTGGAGCTGGCTGTATATAACCTTAAGCAAGCTTCTTG
TGCCCACACGTGATGATCTGCAGTACCGATTTTCATTGGGAGATCCTGTCTCAGTACCGT
CCCACTCTGTAGGTGTACGCCTCTCAGCGGATGAGGGCTGGCAAGGGCAAAATGAGAAAC
CGCCGGAGGATCCAGCGCAGGGGCCCCTGCGTCATCTACAATGAGGACAACGGCATCGTC
AAGGCCTTCCGGAACATCCCTGGTAACGCCACGGTTGGCTCGTGTCCCCGCGCGGAGGTG
CGCTCGCTCGGCTAGGATGATGAGACTCCACTGTGGTCCGTGTTTCTGAAGTCCATGATT
TGTGGAACTTCTGACCTCTCAGCTGAGCGAGCTGCCTGGTGCTGGTGCCTTCCTGTGGCG
CAGGCTCGCTCATTCTCCCTTCCCTCCCACAGGGATCACTCTGCTCAACGTGACCAAGCT
GAACATCCTGAAGCTCGCGCCCGGCGGGCACGTGGGGCGCTTCTGCATCTGGACGGAGAG
TGCCTTCCGGAAGCTGGACGACTTGTACGGCACTTGGCGTAAAGCCGCGTCCCTCAAGAG
CAACTACAAGTGAGTGCTGTTCTCCATGCTGACGGCTGCTGACATTCCAAATCTGCCTGT
TTCCAAGTGGGGGGTTGGGTGGGATCTGCTCTGCCTTCCTGTGGCCGGTGTTTACAAGAA
ATGTGGGGATTCTGCTTGCTGTCTGCTGTGCATAAATGATTTTTTACTCCTGAGATACAC
GTGGGGTTTTAGCTGATCACACGTTACCCCTTCAGCCTTCCCATGCACAAGATGCTCAAT
ACAGACCTCAGCAGAATCTTGAAGAGCCCAGAGATCCAGAGAGCGCTCCGAGCACCACGG
TAGAGTGAACTTGCCCTTGCCCTTGCCCCGCTGTCCTGTTGCTGGCTACTCCGAGGTGCA
CGTGATGTGACTGAAATGCTGACATGTTTTACAGCAAGAAGATCCATCGCCGCGTCCTGA
AGAAGAACCCGCTGAAGAACCTGAGGATCATGTTGAAGCTGAACCCGTACGCGAAGACCA
TGCGGCGCAACACCATCCTGCGGCAGGCCCGGAACGTGAGTGAGCGTGCCCGGGCTCGGG
CAGGCGCACTGCCCCTTGCAGCTTCCATTCTTACTGTGCCTCCTCCCTCGCAGCACAAGC
TCCGCGTGGAGAGGGCGGCCGCGGCACTAGCAGCCAAATCTGACTCGAAGGAGGCGCCAG
CCAAGAAGAAGCCTGTGGTGGGGAAGAAGGTGAAGAAGCCCACGTCCGTGGGCATCAAGC
AGAGAGATGCCTGTGGTGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGAATAAAAGTCCTAAGAGAGATGATGTGAAAAACTGGGTT
GTATGACTCTTAGTACAGAGTACAGAAGCCCACTGCCTAAAGCCAGCTACTTTATCGCAG
GTCACTTTATCTGAATAAAGGCCCTGCCAGAGACGGTGTAGAACACTTACTGGGTTGTGT
GACTTTAAATTCCACCCTCCTTACTTCATTCTCTATTTTACACTGAATCCATGCAAGGGA
AGCCACTCAGTCTGGTAGGTCTGTAAGACCGGAAGTACATGGGTTCAAAGTTAAGCCTCC
CAGGGAACAGGACAACACTCAAGGCAGAGTTGGGTGACACAGACCTCTGCCTTATTAATA
CAAGTGGCCGCACTGGCCAAGGCGGAGCCATGTTGCAGCCAGGAGCCTGGAACTCCATCT
GGGTCTCCCACATGGAGGCAGGGTCCTAAGGACTGGTCAGTGTGCTGTGCGGGGCTGGGT
CAGGAGTAGGGTGCACCTGCGAGGATCCCACAGGAGGGCACAGTGGTGCCCGTGCGGCTG
CGGGCTGCAGGCACCCCGAGACAGCCCCGGGGTACACGGCCTGTGTCATGCGGGGATGCC
CTGCCCCCTCCCAGCAGCACCAGTGTGCACGTTTCACAGCAGAATTCAACTGCTTTCAGG
GCTCCTTGTGGCACCTTCTCCCCTCTGTGGTGCTATTGCGACCCACCGCGATCCTGCCTG
CAGAGGCACCGTTTTCCCTTTTGTGGTCCTACTGCGACCCCCACGTCCCTGCAAGCGGAG
GCACCGTCTCCCTTGCCCGTGGTGGGCTCTGCTCTGCGGTCCCCAGGTAGCCGACTGGGG
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1741..1912, 9924..10030, 10340..10478, 10768..10892, 11292..11421, 11612..11768, 11975..12058, 12154..12274, 12353..12482, 12484..12500
1001..1003, 1741..1912, 9924..10030, 10340..10478, 10768..10892, 11292..11421, 11612..11768, 11975..12058, 12154..12274, 12353..12482, 12484..12500
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved