Oryctolagus_cuniculus Locus ZBTB11
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ZBTB11
Oryctolagus_cuniculus
ZBTB11
GeneScaffold_445
SNORA30
13942..14072
39778
AGTACATACTAGGCCTGGTAAAGATTTTTCATCTTTGGGCCTTGGGAATCTGACCCTAC
ATGAAACTAGATTAGGACTTTAACGCAAGGGGGGAAAAGCAGTTTGCATAGCTTTTTGTG
CCTTAGCATACATTGGCTTAAAATTGAGAGTTCACTTCCTTAAGCTTATGTAAAAATATA
TGCAAATAAACCTTACTAGTGCCAGCTTCTCCCTACCCCTCCCAGCACGATTGCAATTAA
CTTGTAGAAAACCATATATATGCTGATCATTCCAGAAAAATCCTGACCATTCCTTGGTAG
TTTGGAGTTAAGCAATTGGATTTAACAAATGTCAGTTACCAGAAATCGATTTTATAACGC
TTCACTGGTTTTTGCATGTGAAAGGGGTTGTCTTTGGTCTAGTATCCAGAGGCTAATATT
TTGCTAGGAACCCCAAAACCTGACGCTTTTCTAAAGTTGGGGCTTGAAGTTAGATGAAAA
CCGGACTTAGTTACCTCTCTGGGTGCCTCGGGTGGGATCACAGCTGACCACCAGCCCCTA
CACGTGGCTCCTCTGAGTGTGGGAAAGAAGGAAAAAATAAAAAGGGAAATTGCCAGGACT
TAACATGTCTGCTCAAAGCCCTCTAACCTCTATCGCAGGAAGGGCCTACCCGCTTCCAAA
ATGTCTGCCGGCAGCACTGACGTCACTCGATCCCCTCTATCAAACCAGAAAGCCCGTGCG
CTCCAATCCAGCTCAAGCACCGCCCTTACTGGCGTCACTTCCGGTGGTGCAGCAGCCATT
TTGTCAGTCGCCAGTGGATCCCGCGCGCTGGAGAAGTGCAGTTCCCCCTGGTTACCAACT
AGTCCGTTCTCCTTTCGCGCTGCGGGTGCCGTGGAAGAGCGGTCACCAGAGGCACAGCCG
TTCCTGTCTCCAGTGCCTCCGCTGCTGTTGCATCCAACTGGAGCTGGTGCGCTGTCTTCC
TCCCCCACCACTGACAGGCGCCCTCGGAGCCGCCGTCCGCGATGTCAAGCGAAGAAAGCT
ATCGGGCCATCCTGCGCTACCTGACGAACGAGCGGGAGCCGTACGCGCCGGGCACCGAGG
GCAATGTCAAGCGTAAAATCCGCAAGGCTGCCGCCTGCTACGTGGTGCGCGGCGGGACTC
TGTATTATCAGCGGCGGCAGCGGCACCGCAAGACGTTCGCGGAGCTGGAGGTGGTTCTGC
AGCCAGAGCGGCGCCGGGGCCTCATCGAGGCGGCGCACCTGGGCCCTGGCGGCACTCACC
ACACCCGGCATCAGACCTGGCACGACCTGTCCAAGACGTACTGGTGGCGAGGTAAGAATG
GACCCGCGGCAAGGGGGCGGGCTGGGGGCCTGTTACCTGAGGAAAGGCCCGCTAGCGGGG
CCTGGGGCGCACTTGCAGTTTTGAGGGTCTCAAACGCTCCTTGCCGGGCTAGCGCGCGCT
CGGCGGCGGAGCTGCTGCCAGGCGGAGCCGAGAGGGTGGGGGACGGGAAAGGAGCCGCAC
TTCCCACAGGAAGGAGGCCGGGGAAGCGAGGGGCGGACCCTAGCCCGGGGTGGGGCTAAT
GGGGCCTTCCCCGGGAACCGGGCCAACGGCGAGGAAGGGCAGGTGCGCGTCTGCGCCAAA
TCCGCCCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
TATATGGATTCTAGCGCCTCAGCAGAGCTTAACCATCTTTGCCACAATGCTGGCCCTGCC
TGATTTCTTTACTCCAAATATAGCTAGCTGGGGAGAGTAAACAGTGGGTAATCACTGCAT
TTTGTTAGGGTTGATTTGTTTTGACATTGTTTTGTTAAACAAATGTATCAGATTTAATAG
TTCAGGAAACTGTGAAAACCAAAGGTAACATTGACCAAGCTTTTACATGCAGACATAGTT
TTGAGCACTTAATTTGTTTCCACTCAATCTTCATGAAGCTTTGTGAGGTAGAAAATTTAT
ATCTCCATATTACAGATATAACCAGGAGATTACACAGCTGATCTCTGGGATTTCAGCTCT
TGTTAACTACTGTTATATGGTGTTTAGTGCTCAGAATTTTCTTTTCCTTAATTGATTATT
TGTGGCTGATAGCTGGTGTGGCTGATAGCTAGTCTAGCTTTTTGTTTGTTTGTTTTATTG
TTAGTATACAGTGACCAAAAAGACAGTGAATAAAAGATAGTGTTACCTTAATTTTTTCTT
TTTTTGAAGAATAATTTATTTGACAGGGAGGTTTACAGAGAGAAGACAGAGACAGAGCTT
CCATTTGTTGGTTTACTCTCCCAAATGGCCACAAAAGCTGGGGCTGGGCCATGCCAAAGC
TAGGAGTCAGGAACCCCATGTGAGTCTCCCAACTGGTGGCAGGGCCCTGAGTACTTAGGC
CATCTTCCCCTGCTTTCCCAGGCACGTTAGTGCTGGATTAGAAGTGGAGTGGCTGGCCTC
AAAAAATGTATGAGATGCAGGCATTGTAGGCAGCGGCTTAAACTGCTGTGCCACATGCGG
GTCCCAGTGTTAATCTTTAGTTTCACATACTTGAAAAGCAGAGCAACAGAGAGACAGTTG
AGAGAGACCTTCCTTCTGCTGATTTACTACCCAAATGCCCAAAACAGCCAGGGCAGCCCA
GGTTGAAACAAAAAGTGCTAACTCCATCCAGGTCTCTTACATGAGTGCCAGGTGACCAAG
CACTTGAGCCATCACATGCTGCCTCTCAGGCACATTAGCAGGAAACTGAATTGAAAGCCA
CTGAGTAGCCGGTACCTAACCAGACACTATAGGTTGTGGGTGTTCCAAACCACAGCTTAA
TTCACTGTACCAACACCTATCTTCACCTTAATTTAAAAATGAAAGATAATGTTTGTGGTA
ATTCTGTGTGACTCTGCCTTTCAAATAAGTAAAATTTTCAAAATATTTTTAAAGATTTTA
AGCAACTTATTTTTTTTTTAGTAATTAAGGTTTTTTAACTTTATTGATTCTACTTTTAAG
AGATGTAAACAGGTATAGGTTATGATGTAGAACTTATAACTGATTAAAAAAATAGCATTT
TAAGTTATTTATTTGAAAAAGTTATTTATTTGAAAGGCAGAGAGAGATCTCTCATGTAGT
TCACTCCCAAAATGCCCATAGCTGTTGGGGTTGGGCTGAGCCCCACTGAAACCAGGTCCC
AAGAAACCAAATACTTGAACCATCACCCACTGCTCCCTAGAGTGTGTATCAGCAGGAAGC
TGGTGTCAAGAACAGAGCCAGAACTTGAACCCAGGCACTTCTATATGGGATACAGGCATC
CTAAGCCATGTCTTAACCACTAAACACCTACCAAAATAAGCAGTTTTTAATATGTCATAA
ACTACCAATGGATTTTTTAGAAATATACTCCAAAGCAGTTGTAGATTTTTATCTGGGAAC
TAGTAAGACTTAGTCAATATAATTTAAATGCTGAGAAAAAAAAAAAAACAAACTGTTGAT
TCTATCCCTTTTTTATTTTCGATTTATCTCTGGTGTGTGTGCTGGAGACAGTGCTTCAAA
ACCAGTCCACTAACAGTTGTATCAGGCATGGTTTTCTAGGATTCATTATTTAAGCTGCTG
TTTCTGGAATGCTTCCATCATACTATAAACCAGTGTGTAGGCAAGATTATAGCATAAATT
TTCCTTTTTTTGGGCACAATGAAAAACTGTGGCTTAGTGCCTAATTTTTGGATATTAGCC
ACCAAACTTATTTCAAAATGTAAAATGTTAATAGGTATTTTACCCGTACCTTTGTTATCC
TATATTGCGTGTGCTGGAGTTTCAAAATGAATCTCCCCTGCCTCTGTCAAAAGCTGATAT
TGGAACCTACTATTAAATGCATCCCAAGTAAAGATTAGTTTAAATTAGAAGGTTAAAAGG
GTTTAACTAGCAGAATCATCTAATGTGTTAAATTAGCAGCCAGCAGCAGTTCCTACCCTG
ACAACTCATTTTTGTTTAGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGGCTTCTGAGCGGCATAGTACTAGCCATTATGGCTAATGGGCGAGTAGAAGAACCAG
CAGATGGAAGACCTAGCTCGCTCGCTCTCTCTCTCTCTCTCTGCCTCTCATTTTCTCTGT
ATAACTCTGACTTTCAAATAAATCTTTTTTTTTTTAAAAAAAAGGATTGTCTGGCCCAGC
ATGTGAATACAGAGGGTCCCCAACTTAGATTCTTGTGGATTTTCCCACTTTACGATAGTA
TGGAATCTATATGCATTCAGTAGAAACCAGACTTTGAATTTAGTATACTCTTTGATGATG
CTGGATGCCAGCAGTAAACTGCAGCTCCCAGTCAGCCATGTGATCGCTGGTAAACAAGCA
GCATTTTTTTTTTTTTAAACAGATATATTTATTTATTTGAAAGGCAGAGTTACAGAGAGA
GTAGACACAGACTGGGGCTAGGTCAGGCTGAAGCCAGGAGCTTTTTCCTGGTTTCCCACA
TGGGTAGTAGGGGCCCAATGACTTGGGCCATCTTCTTTCACAGAAGGGGCATTAGAAGAG
AGCTGGATCAGAAGTGGAGCAGCCAGGACTCGAACCCAGTACCCATGTGGGATACTGGCA
CTGCAGGCAGTGGCTGAATGTGCTATACCATAACACCAGCCTCTACAGGTGGAATTCTGC
AGTGAATCTGTTGCTGAGCCGTGATGATCTGTAATAGATGAGTGTGTTAAATGTATTCTC
AACTTGAGATATTTTCAATTTACAGTGGGTTTATGAGGATATAACTTACAGTAAGCTGAA
GAGCATCTGTCCTGAGGCAGAAACTGCCCCTCAAGCTGGTATTGTTTTCTTTTTTAAGAT
TTATTTATTAACTTGAAAGACGGTCACAGGAAGAGGGAGAGATCTTCTATCTGCTAGTTT
ACTCCACAAATGGCTGCCAACAGTTGGGGCTGGGCCAAGACAAATCCAGGAGCCTAGAGC
TGTGTCTAGGTCTGCCATGTGGTTGCAGGGGCCCAGACATTTGAACCAGCATTCACTGCT
TTCTCAGGTGCATTAAGCAGGAAGTTGTAATGAAAGTAGAGCAGCCAGGACTCCAGCTGT
CACTCAGATATGGGATGCTGGTGTCATAAGCAGCAGCTAATTTACTGTGTCATGATGAGC
CCCTCAGGCTGTTTTTTTTTTTTTTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACTAGAT
CGTTCTCGTCCCAATATCAGATGCCTTCAGAAAATGTGGAAGAATTGGGACTGGACCTTG
AATCTGGAGAAGAAAAGTAATGAATCAGAGGATGACCTGAGCAACTTCACTTCACCTCCA
GCTACAGCCTCCAAGCCTTCCAAAAAGAAGCCAGTATCCAAACATGAACTTGTCTTTGTA
AGTAGTGCTTTGCATTCAGATTTAATGTTTATAATTAATTTACTAGTGTTTGCAGACCTG
GCAAATTTTATTTTTCTCAAACCACTAAGACTGGTTGACTACCAGTACTGATGCTGAAGT
TTTTTTTTTCTTAAAGGGATATATAGTGTCATTTATTGTTTTTTTAAAGATTAATTTATT
TATTTGAAAGTCAGAGTTACACACAGAGAGAAGGAGAGGCAGAAAGAGAGAGGTCTTCCA
TCCTCTGGTTGACTCCTCAATTGGCAGCAACGGCCAGAGCTGAGCTGAGCTGAAGCCAGG
AACAAGGAGCTTCTGGGTCTCCCATGCAAGTGCAGGAGCCCAAGGACTTGGGCCATCCTC
CACTGCTTTCCCAGGCCACAGCAGAGAACTGGATGGGAAGTGGAAGAGCCGGGATCAAAC
TGGCGCCCATATGGGATGCCGGCATTGCAGGCCGCGGCCTTACTCGCCACGCCACGGTGC
CAGCCCCGATGCTTAAGTTTTAAAAGCAGATCTATCTATATGTCTGAAGTATAGTCTATT
GATTATAAAGCTAAATGGGTAATATGCCATGTTGCTGTTTAAGCTAAAGATAAGTTAATA
ACTTCCTCATCATTGATCATAGGTGTCTGGGTATTCTCTTTAGAATGAATTTAGTAAGCT
GTTGGTTTTTTGTAAATCTTAAAAGGGGGGGCTTTTAAGATTTGCTTATTTTTATTTGAA
AGACAGAGTTACGGAGTGAGAGGGAAGGACACAGAATGATCTTCCATCCACTGATGCACT
TCCTAAATGGCCATAGGGGCCAAAGTGCTTAGGCCATCTTCCACTGCTTTCCCAGGTGAC
ACGTGGAGCTGGATAGAAGTGGAGCAACTGGGACCCAAATTGTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAA
AAACACAACCTCTTTTTTTTTTTTTTTTTAAGATTCTTTTTTGAGAGGGAGAGATAGAGA
GGTCTTCCATCGGCTGATTCGCTCCCCAGATGGCTTCAATGGCTGGAGCTGAGCCGATCT
GAAGCCAGGAGCCAAGAGCTTCTTCTAGATCTCCCATGTCGGTGCACTTGGGAGCACTTG
GGCCATCTAACACTGCTTTCCTAGGCCATAGTGGAGAGCTGGATAGGAAGAGGAACAGCT
GGGGACATGAACTGATACCCATATGGGATGCCGGTGCCATAGGCAGAGATTTAGCCTGTT
CTGCCACAGTGCCAGCCCCGTAACTGTTTTTTTTTTTTTTTTTTGATTGCTTTTGTATCC
TACAATTTTAATGAATAGTTTATTTATTAGTTCTAATATTCTCTCAGAATATTTAGGTTT
TCCTTCATGTTGAACCGGGTTATCTGCAAACAAGGATTATTTTACTTCCTCCTTTCCTGT
TTGTATGCCTTTTTTTTTTTCTCTTAATTGCTGTAAATTGCTCTTAATTGGCTAAAACTT
CCAGTAGTGTATTGAATAAGGGAAGTGAGAGTGAACATGCTTGCTTGTTTCCAGATCTTA
GAGAAAATGCTTTCAACTTTTCCCCATTTAATTTTTTTTTTTTTTTTTTTTTTTTTTGAC
AGAATGGACAGTGAGACAGAGAGAAAGGTCTTCCTTTTTGCCGTTGGTTCACCCTCCAAT
GGCCGCCGCGGCCGGCGCGCTGCGGCCGGCGCACCGCGCTGATCCGATGGCAGGAGCCAG
GAGCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACCTGGGCCATCCT
CCACTGCACTCCTGGGCCACAGCAGAGGGCTGGCCTGGAAGAGGGGCAACCGGGACAGAA
TCTGGCGCCCCGACCGGGACTAGAACCCGGTGTGCCGGCGCCGCTAGGCGGAGGATTAGC
CTAGTGAGCCGCGGCGCCGGCCCTATTTAATATATTTTTGACTATTGAGTTTGCCTTTTT
TTATGTTGAGGTATGTTTCTTCCATACCTGATTTGTTTAAGGGTTTTATCTAACATTAAT
GGATGATGAATTTTTTTGAATACTGTTTCTGCATCTGTTGAGGTGATAATACGACTTTTA
CCCTTTTTGTTCAGTTGGTTTGTTGTATTGTGTTTATTGATTTGCCTACGTTGAACCATC
CCTGGGATAAATCTCTGTTGATCATGGTAAATGATGTTTATGGTGTGCTATTGGATACAG
TTTGCTAATATTTGAGAGAGAATTTTTGCATCTATGTTCATTAGGTATACTGGTCTATAG
TTTTCTTTTTTGTTGTTAGTCTTTTTTTTTTTTTTAATTAATTTATTTGAAAGTCAGAGT
TAACACAGAGAGAGAAGGAGAGGCAGAGAGATCCAGCTCTCTGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGGTAGCCAATCAGGCTTTTGTCAATATCTATTTGCAAGTTAGCCAGGAGAACTTCA
AGTTGGGCTCTCTGTTGCTCTACGAAGTCTAGTTGGATGTGTGAGCTCACTGTCTTTTTA
GTTGGAATATCTGTGAGGCCCCAGAAATGGGGTGTGTAGAAACTTCTGTCTCCTAGGGTG
CTATAATTTCTGACAGTGACTCCTTTTTTCAATATGGTGCTACACTGTTGCTGTCTCTCT
GCGGTGATTATGGGGGATACAATGTGAATTCCTTCTCTGTAGTATTCTACAGGTAGCTCT
CTTTACTGGGCTCCTACACTATAAGACTGACTTCATTGCCAGCATAAGGTGTCTCCCCTG
CAATAGGGATTCCACCCAGCCATGAAGGATCAAGGATCTCAGTTTCTGGTTGGTTTTGTT
TCTCTCTGCTGCCCTCACAGGTCTCCTGTTATTCCCTCACTGAATTCTAGTGTTGCTTCT
TGGGGCAATCACCTTAAAACGCGCGGCTATTTATTTGTTTCTTTAGTTCTGCCCTGTGGA
GAGGAAGACAAATGGTGGGTATCTCTATTCAACCATCTTGAACTCTTCCCCTCCCCCCAC
CATGTGAGGCTTGTTTCCCACCCACTAGTAAGCAGTGAATTCTGTAGCAGAAACCAACAA
GGATCTTTTTGTTGTTGTTGTTAAAGATTATTTTTTAAAGATTATTTATTTATTTATTTA
TTTTTGTTTATTTATTTATTTTTGGCAGGCAGAGTGGACAGTGAGAGAGAGACAGAGAGA
AAGGTCTTCCTTGTTTTGCTGTTGGTTCACCCTCCAATGGGCCGCTGCGGCCGGCGCGCT
GCGGCCGGCGCACTGCGCTGATCCGATGGCAGGAGCCAGGAGCCAGGTGCTTTTCCTGGT
CTCCCATGGGGTGCAGGGCCCAAGTACTTGGGCCATCCTCCACTGCACTCCCTGGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTATTTAATTTTC
TGTTCTTAGTAATTGTTTTCCTCTAGCACTTTCACAGATCTTCCCCTAGGCAGTAGGGCC
AGGATTTGGTAGCTGGTGCTGAAAGAAAACCGTTGATTGTATCTTTGCCAAGGTACTATA
TACTGGTGGCAATTGACATTCAACGGGACAGAAGTGGAAACATTGTTTTCCTTCTAATTT
GCTTGAGTATTCTCTCTTTTAGCGTAATGCTTAGCCCATTAAATTCCTGCCTTTCTTATT
TTCCTTTTTCAGCATTTCAGATTTTTCTATAAATAATGTGGATTTATTTATACTTTTTTA
AAGTACACCATTTTTTAAAAAAGATTTATTTTATTTATTTGAAGGGCAGAGTTACAGGTT
ACAGAGAGAAAGGGAAAGAGAGAGGGTTCTACCATCCTCTGGTTCAGTCCACAAATATTT
ACAATGGCTGGGTCTAGGTCAGGTTGATGCTAGGAGCCAGTAGTTTCTTCCAGGTCCCCC
CCTGGAAGTGCAGAAGCCCAAGGACTTGGGCCATCTTTTGCTACTTTCCCAGGCACATTG
GCAGGGAGCTGGATTAGAAGTGGAGCTACCAGGACTTGAACCAGCACCTTTATGGGAAGC
TGGCATAGTAGGTGGTGGCTTTACCTGCAACACTATAGTGCCAGCCCCTATACTTGTTTG
CTTTTTTTTTTTTATCTTTTCGAAGTTTATTATTACTGTTATTGATGTTTTATATTGTTT
TTATTTTTTATTGGCATGTAATAATTGCATGCAGTTATAGGGTGAAATATTATGTTTTGT
TTCACATATTTATTGGGTAGTGATCAAATCAGGTAAATTAGCATATCTGTTGCCTAAAAG
TTTTTTTCCAAATAAACCTTTTATTTAAGGAATACAAACTTCATGCACTTCATAAGTACA
ACTTTAGGAATATAGTGATTCTTCCTGCCATATCCACGCTCCCACCCCTCCTCCTCTTCT
CTCTCCCATTCCCCACTAAGATCCATTTTTGATTAACTTTATACACAGAAGACTATATAG
TAAGTAAATAGTTTACCAGTTTTCATGAAGAAAAAGTGTTCCTCAACAGTTGAGACAAAG
GGCTGTTCAAAGGCATTGCATCTGAAGTTAATTTCACTTTTTTTTTTGAAACTTAATTAA
CTTTAAAGAAGCGCTCAAGAGTGATACATCTTTTTCAAGGTCTTAGACATAATTATAATA
CAACTCTTTGAGGACAGAGGTCCTGCATGGGATGTTAGCGCATAGTGACTCCTGTTGTTA
ATGTGACATTTAATACTCCTATGTATGACGTCAGTGACCACCTTAGGCTCTTCACATGAG
CTACTTAGGCTGTGAAAGCCTTTTGAATCCACAGACTCCACCAGTATTTAGAAAAAGTGG
AAGTTCTCTCCTCTCTTCTGAGAAAAGTACATCCTTCTTTGATGACCACTTCTTTCTGCT
GGGGTCTCACCCACCGAGGTTCTTTAGTTAGGACATTTTTTGCCACAGTTCTTGGCTTTC
CATGCCTGAAATGCTCTCATGGGCCAGACCAGAACGCCTTAAGGGCTGATTCTGAGATCA
GAGTGCTACTCAAAGCGATTGTCATTTTATGAGTCTGCATTCTATGAGACTGCTTCCCAT
GTTGGAGCCTTCACTCCTTTTTAATTCTATCTATTATAATTACCAGACTCTTAATCCTAT
CCATATGACTGCTCTAACACTTAAGATGGTATTTTTACCACCGAGCTTAAGGGGATTTGG
GGCCTCATGGCCAGTTTTTAAACTGTACCCTTAGAAGTAAGCATAGGGATGTATGCAGAA
CTATACAGCTTTACAGTTACAGTCTTCATATACTTCATAATTATGGCTTTAGGAACATGG
TGATTCTTCCTACTGTGCCCTCTATCCCACCCATAGTCCCATCCTTCTTCCTCCTCTCTC
TTATTCCCACTCTTATTTTTTACTGAGATCTATTTTCAGTTAACTTTATACACATATATT
TAACTCTATGTTAAGTAAAGAGTTCAGCAAATAGTATGGAAAAAAAAAGACTTCCTCATC
TGTCAAGACAAGGGCTGTTGAAGTCATTGTTTCTCAAAGTGTCAATTTTACTTCTACAAA
TTGCCTTTTTGGTGCTCTATTAGTTATCACAGGTCAGGGAGCACATATCATATTTGTCCC
TTTGGGCCCTATACTTGGTTTTCACTCTCCTTGTGGTTCTCTTTACACAGATGTATTTTG
TTTGAAAAGAATGTACATTTTTTTTTTAGTTGGGTGCAGTTTCAGCATATTGTGCATTAT
ATTAAGCTATTGTTAATTTTTTTTATAACTTTATTTTCAGTTTGTTTTGAAAGGCAGACA
GAGACAAAGACACAGACAGGGAAGTATCTTCCATTCAGTGGTTCATTCCTCAAACGCTTG
AAATAGCCATGACTGGACTAGGCTGAAGCCAGGAGCCCAGATCTCAATACAGGTCTCCCA
TGGGTGTGGCAGGGACCTAAGTAGTTGAACCATCCTCTGCTATCTCCTAAGGTGTGCATT
ATCAGGAAGCTGAATTTGAAAACAGAGCAAGGACCCAAACCTTTACAGTTTGATATGAGA
AATAGGTGTCACAAGCAGCATCTTAACCAATGTGCCAGACATCTGCCCCCATGTTAATTT
AAAAAAAAATAGCTATTTATTTATTTTATTTTAACTTTTATTTAATGAATATACATTTCC
AAAGTACAGCTTATGGATTACAATGGCTCCCCCCCCATACCTTCCCTCCCACTCGCAACT
CTCTCCTTTCCCACTCCCTCTCCCCTTCCATTCACATCAAGATTCATTTTCAATTCTCTT
TATATACAGAAGATCAGTTTAGCATATATTAAGTAAAGATTTCAACAGTTTGCATCCACA
TAGAAACACAAAGTGAAAAATACTGTTTGAGTACTAGTTATAACATTAAATCACACTGTA
CCGCACATTAAGGACAGAGATCCTACATGAGGAGTAAGTGCACAGTGACTCCTGTTGTTG
ACTTAACAAATTGACACTCTTGTTTATGGCATCAGTAATCATCCTAGGCTCTAGTCATGA
GTTGCCAAGGCTCTGGAAGCCCCCTGAGTTCACTGACTCTGATCATATTTAGACAAGGTC
AGTGTGGAAGTTCTCTCCTTCCTTCAGAGAAAGGTACCTCCTTTGATGACCTGTTCTATT
GGGGATCTCACTCGCAGAGATCTTTAGGTGTTATTTTATTTTCGTGCCAGAGTGTCTTGG
CTTTCCATGCCTGAAATACTCTCATGGGGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTGGCTGGCTCAGACATCTCCCCGCTCCTCGCCCTCTACGGATGAC
GAGCAGCAGCCGTCCCCCTCTCTCGCCCTCATCTCACTCACCTTAATCTGGGCATTTACT
GTCTTCGGGGTTTTTTTTTTTCCCCAGGGTGTCTTGCCTTTCCATGCCTAAAATACTCTC
ATGGGCTCTTCAGCCAGATCCGAATGCCTTAAGTGCTGATTCTGAGGCCAGAGTGCTATT
TAGGACATCTGCCATTCTATGAGTTTACTGTGTATCCCGCTTCCCATGATGGATTGTTCT
CTCCCTTTTTGATTCTAGCAGCTAGTATTAGCAGACACTGGACTTGTTTGTGTGATCCCT
TTGACTCTTAGACCTATCAGTGTGATTGATTGTGAACTGAAATTGATCATTTGGACTAGT
GAGATGGCATTGGTACATGCCACCTTGATGGGATTGTATTGGAATTCCCTGGCACGATTC
TAACTTCACCATTTGGGGCAAGTCCGATTGAGCATGTCCCAAATTGTACATCTCCTCCCT
CTCTTATTCCCCACTCTTATATTTCACAGGGATCACTTTTCAGTTAAAATTTAAACACCT
AAAGAATAATTGTGTGTTAATCACAGAGTTCCACCAATAGTACTAGAACAAAACAAAGAG
AAAATACTAAAATGGATAAAGTATTACATTGTACATCAACAGTCAGGACAAGAGCTGATC
AAGTCACTGTTTCTCATAGTGTCCATTTCACTTCAACAGGTTTCCCCCTTTGGTGCTCAG
TTAGTTGTCACCAATCAGGGAGAACATATGATATTTGTCACTTTGGGACTGGCTTAGTTC
ACTCAGCATGATGTTTTCCAGATTCCTCCATCTTGTTGCAAATGACTGGGTTTTACTGTT
TTTGACTGCTGTATAGTATTCTATAGAGTACATGTCCCATAATTTCTTTATCCAGTATAC
TGTTGATGGGCATTTGGGTTGATTCCAGGTCTTAGCTATTGTGAATTGAACTGCAATACA
CATTAATGTGCAGACAGCTTTTTTGTTTGCCAATTTCATTTCCTTTGGGTAAATTCCAAG
AAGTGGTATGGCTGGGTTGAATGGTAGGGTTATATTCAGGTTTCTGGGAGAGGGAGGGAA
GCCATTATAATCCATAAGCTGTACTTTGGAAATTTATATTCATTAAATAAAAGTAAAAAA
AAAAAAATATTCAGGTTTCTGAGGAATCTCCAGACTGACTTCCATAGTGGCTTAACCAGT
TTGCATTCCCACCAACAGTGGGTTAGTGTCCCTTTTCCCCCACATCCTCTCCAGCATCTA
TTGTTGGTAGATTTCTGAATGTGAGCCATTCTAACCGGGGTGAGGTGAAACCTCATTGTG
GTTTTGATTTGCATTTCCCTGATTGCTAGTGATCTTGAACATTTTTTCGTGTATCTGTTG
GCCATTTGGATTTCCTCTTTTGAAAAATGTCTATTGAGGTCCTTGGCCCATCTCTTAAGT
GGGTTTTTTATTTTGATGTTGTGGAGTTTCTTGATTTCTTTGTAGATTCTGGTTATCAAC
CCTTTATCAGTTGCATAGTTTGCAAATATATTTTCCCATTCTGTCGGTTGTCTCTTCACT
TTCCTGACTGTTTCTTTTGAAGTACAGAAACTTCTCAATTTGATGCAATCCCAAATGTTA
ATTTTGGCTTTGACTGCCTGTGCTTCTGGGGTATTTTCCGAGAAGTCTTTGACAGTACCT
ATATCTTGCAATGGCCAAGCCTGGGCCAGGTTGAAGCCAGGAGGCAAAGCTTTATCCAGG
TCACCCATGTGGATGCAAGTTGCCAAGGACCTGGACTATCTATCTTCCATTTCTTTCCCA
GGCACATTAGCAACGAGTTGGATTGGTGGCAGAGCAGCTAGCACATGAACCAGCACTCAT
ATGGGATACCAGCAGTGCAGTCAAGCAGCTTAACCCAGTATGCCACAGCACCTGCCTCCA
ATAAAATAATCTTTACTGATTATTTTGTGTACTCTGTCTGTTGGTACTCCATTTTTCTGA
TTCTCATTAGAATTTCTTCAATCTTTGTTTTCTATATCTTGAGGCCATGCTGTTAGGTTC
TTGTGTGTTTAGAGTTATTGATTCATGATAAAACATCCTTTATCATTATGTAGTAGCTAT
TTTTTCAAAGATTTGTTTATTTGAAAGAGTTACAGAGAGAGAGAGAGAGACACCTTTTGT
CTGTTGGTTCTTTCCCCCTATGGCCACAATCGCTGGTACTGGGCCAGTCTCCCAAGTGGG
TACAGGGCCCAAAGACTTGTTCCATCCTCTACTGCTTTTCCCAGGCCATTAGCAGGGAGC
TGGATCAGACATGGAGCAGCTGGGTCTAGAACTGGCCACCCATATGGGATGCTGGCATTG
CAGGTGGCAGCTTTACCTGCTATGCCACAACGTCAGCTCTGTGAATAATACTGTTGTGGT
TTTCCTGGGGTATCTTTTCTTCCATATTTTTTCAGTTGCTTGGTATCTTTATGCTCTTGA
AGTCTCCTTAAACATTGTCCTTCTGGATTTTGTTTATAATCTGTTAGGAATATATTTGAC
TTAATCCTGTGTGGAAATAGACTTCTTAATTATGTGGATTGTTGTCTTTCATCTGTTGAG
AAACATTCTTTACTAGAAATTATCCTACCTAATTTCTTTCTTCTACCATTCTGAAACTGA
AATTAGATACCCAATTTATCTTGTCTTTTAATCTTCCCTCGTATATTTTATTTCCTTCTG
ATTTACTCTGGAAAATTCTGAAAATTTATTCAGTCTGTTTCCTTTACCAGGTAATAACAT
TACTTCAAATTTTTCTGATTTGATTTGGGCTGTTTCTGCTAGCTTTTGTTTATGGTGCCT
TGTTTATTTTTTAAACTGTGTACATTGGTTATTATGTTTAGAAGTTTGCAGGAAATATTG
TTGAGTTGGGTTAAAGATGTCTTCCACAGATGAAACATTTGATTATTTGGATGCTGGGAA
TATTATTGATCTGAAACCACTTTAAATTCTCAACTTGATTTTTTTTTAGACATTATAGTG
CTGTATATTCAGCAAATAAATCAACAAATGAAGCCTGGTTTATGGTCATGGCCATTCAGG
GAAAATTTTGGTACTCTGAATCTTAGTACCATGGCACTGAGTATGTTTGAAAGTATTTCA
AAAATACTTTTAACTACGTAAAGTGTCAGTGTTAGCGAACATACTACTAGGTCTAAAGTC
CTTGTCATAATTTTATATCTGCAGTAATTGTTGTCTTTCGAGATGAGACTTTAAAGTTTT
TTAATTGTGAAGAAAACAAAATATACCCTCTTAATGACGTTTTAATACAATTCAGTAGTT
TTAACTATATTCACATTGTCATGTAGAAGATCTCTAGTTTTCTTTCTTTTTAAATTAATT
TTTAACAAATTCAATGTGATTTGTAGTTCTTTTTTATTTTATTTATTTATTTTTGACAGA
GTTAGACAGTGAGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTCTTCTGTTGGTTCACCC
CCTCCCCCCACCAAATGGCTGCTACGGCTGGTGCGCTGTGCTGATCTGAAGCCAGGAGCC
AGGTGCCTCCACCTGGTCTCCCATGCGGGTGCAGGGCCAAAGCACTTGGCCATCCTCCAC
TGCCTTCCTGGGCTATAGCAGAGAGCTGGACTGAAAGAGGAGCAACCGGAACTAGAACCT
GGGGTGCCGGCGCCGCAGGCAGAGGATTAGCCATGTCAGCTGCTACTCTGGCCATAGTTT
TCTTTCTTTTTTAAAAATATATTTATTTGAAAGGCTGAGATACAGAGAGGAAAAGGGAAG
AGAGGGAGGGAAGAAGGGAGAGAGAGTTATTCCATCCATTGATTCACTACCAAAATGGCC
ACAATGGCCAGGGCTGGGCCAGGCTGAAGCCAAGAGCCAGGAGCTGCTTCTGGGTCTCCC
ACATAGGTGCAGGGGCCCAAGCAGTTGGGGCATTTTCCACTGCCTTTCTAGGAACATTAG
CAGGGCACTGGATTGGCAAGTAGGAGTCTTCTGGGACTTGAACCAGTGCTCATATAGGCA
TGATCGCATGCAAGCAGCTGCTTAATCCACTGTGCTACAGCATCAGCCCCCTACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAGCATAGAATAACCAAGACTCAAATCAGCTACTGCAATATGGG
ATGTAGGCTTTCCATGGTGTGGCTTATCCAGTTGTGTCACAGTGCCCACCCAATTAAGAA
ATATTCTTTTATCAAGCCTAAATTGGTCTCGTAATTTGTACCAGGATTAATATAGTTTTA
GCCTATTTAATTGTCAGCTTTCCTAGGAATGTGTGAAATAGCTATGATGGTTGATGGTAG
TATTGGTAATGTACTTTCTTCAGTGTTCCACCTTACTCCTAACATATCCACAGTTAAAAG
GTTTTCTTTATACTTGTCCATCCCTCATCTGCCAACTTAAATTTTACATACCTTAAGTCA
AAAGTGAGACACAGCAAATTTGAGTTTTTAAACTTTGATTTGGTTTTCTCTATATTAAAA
AACATTTCTAAGATAAATTATTAAATGAGAGAAACAGGTACAGAACAGTATGTATATAAT
GCACCTATGTAAGGAGGGAAAATAAGAATATTTGCTTGACTATAACAAAGAAACTGGGAC
TGGTGTTGTGGTGCAGTGGGTTAAGTTGTTGCTTGTGATGCCAGCATACCATATGAGTGC
TGGTTCTAGTTCCAGCAGCTCTGTTTCTGACCTAGCTCCCTGGTGATGCGCCTGGGAAAG
CAGTGGAAGACAGCCCAAGTGCTTGAGCCCTGCCACCCATATGGGAGACCCAGATGGGAG
TACTTGGCTCTTGGCTTCAGCTTGGCCCTGTCCTGAGTGTTGTGGCCATTTTTGGAATGA
GCTAGCCAGTGGAAAAACAGCTCTTTCCTTCTCTCTGTCATTCTGCTTTTCAAATACATA
AAATATAGCTTAAAAAAAAAAAAAAACTAGAAAGCTATAAAAAACCTTCTGGTTTTTGAA
TCATGTAAATATTAAGAATTAAAAATTGCTCTTGAAAGTGAAGGACTGAACACTTGGAAG
TGATATAAACTGGCCTTATTTTCCCAAACAAAATAAGAATGTAATCCCTCCTGTCTTTAA
GTATTTCATTCCTTAGATCCAGGATAGGCAGGCTATAGCCCAAGAGAGAATCCTCTTCCC
TTCCTTCTTGTCAACAAGATCACATTAGCACACAGCCACACCCTTTCATCTTCATAAGCT
TTTGACCTGTACAGTACAGCACACACCCTATGGCCTGCACTATTTATCATTTGACTTTTT
GAAGAAAAATTCACTGACTTCTGCCTTATACTGTTTTTTTTTTTTAATTCTTAGAACACT
TTGTTCGATCAAAATTTCATTTTAGCTGCTGTTACAAAAATATATATCTGTACTTACTGA
AGTGAGGTTAGGTAGGGCACAAGTTAGTTTAACCCTGACTGCTCACTTGCTGCCCTCCCA
CTCCCTTCCCCACTCCTTTTTCCTATTCTGCATGTTCAGCAGCTATTTCTTGAGTGGAAT
TTAAGGAACATTAAGGGTTCTAAAGAATATGGTTTGAAAATAACTGCCTTACAACAACTT
TTTTTTTTTTTTAAAGATTTAATTATTTAAGAGGCAAGTTACAGACAGGGAGAGAAGAGA
TTTTCCATCTGCTGGTTCACTCCCCAAATGGGTACAACAGCTGAAGCTGAGCCTATCTGA
AACCAGGAGCTAGGAGTGTCTTCCAGGTCTCCCATGTGGGTGCAGGGGCCCAAGGACTTG
GACCATCCTTTGCTGCTTTCACAGGCTCATTAGCAGGGAGCTGGATCAGAAATGGAGCAG
CCAGGTCTTGAACCGGCACCTATATGGTCTGTTGGTGCTGTAGGCAGAGGCTTATCCTAC
TAAGCCACAGTGCCAGCCCCGTAAAACAACTCTTGAGGTAGTAAGTTACACTATTTTCTT
TATTAGTTATTGAGAAGCTCGGTTTGTAGAAGTGACTTAGTCAAGGTTTAATAAGTAACT
AGAACAGAAAGCAGATCCAGAAGAGATTTAGGGCAGGATGAATGGTCATATTTGCCTTTT
TATTAAATTTTATATGTCATAATCTATGTTAATAGTTCTTACAAGCTGATTTGTTGATGA
TTGGCTTTTTTGTCCCTACCTTTCTGTTTCATACAGGTTTTTGTAAGGCAAGTTTCCTTC
CTTTACTGGAATTTGCCTATACTTCTGTGCTAAGTTTTGACTTCTGTAGCATGGCTGATG
TCGCTATCTTAGCTCGTCATCTTTTCATGTCAGAAGTTTTAGAAATTTGTGAAAGTGTGC
ATAAACTAATGGAGGAAAAGCAGCTAACAGTATATAAGAAGGGCGAAGTACAAACAGTAG
CATCTACCCAGGACTTACCAGAACAGAATGGAAGTACAGCGCCTCCTGCGGCTAGCAGTG
AGGGAACTACAACAACTGTTTCTACTGGACTTGAGGATTGTGAAATTGTGCTACTGATAA
ATGGAGAATTGCCTGAAGCTGGACAGAATGGAGAGCTGGGAAGACAGCCTGGTCCCCAGG
TTTCTTCAGAGGCTGGAGCTGCTCCATCATCTGTGGGGTGTGTATCTGATTCCCATTCTG
AAGTCGAATGTGTTGATTTGGTAACAAAAAATAACCCTACAGAGCTAGAAACTTCAAACA
TCAGAGAAGATAGCACAGTTTCTAATATGCCTTGTAAACTTTCAAGAGAGAATATTATCA
GTAGCCCTCCAGAGAACAGTGACATGGGAAATGATACATTAACTGAAGATAACTGTACTG
AAGATATTCCAAAACATGTACAGAATGTTCATCAGCCTTTAGAAGATCAGGAAAATCCAA
GTGCACTGACAGCACAGACAGACATTGGCCCCGATGATGACACTTACAGGAGCAGGCTTC
GGCAGCGTTCTGTGAATGAAGGAGGATATATTCGACTACACAAGGGCATGGAAAAAAAAC
TGCAGAAACGGAAGGCCATTCCCAAGTCAGCGGTTCAACAGGTATGATGTCAAGAGTTGA
CCTTTGTAGTTGTAGCTTTAGATTGAAAGCATTCTATTTATAAACTTATGCCTGTGGTGG
AAATTATTTGGGAGGGGAGACAGATTCAGGACAGCGACTCGGTGTTATTAAATGCCAATA
TTAATAAGGTAATGTGGATTTGAAATATTTTGACTCAGTGTATCTACTTAGATTGTTATC
TGTCTCTTAACTAGGTGGCCCAGAAATTGGTTCAAAGAGGAAAAAAGATGAAACAGCCAA
AAAGGGATGCCAAAGAGAGCACTGAAGAGGTGTCTCATAAATGTGGGGAATGTGGAATGG
TTTTTCAGAGACGATACGCCCTTATAACACACACATTAAAACATGAAAGAGCTAGAGATT
ACAAATGTCCCGTAAGTATCCAGACAGCTAACTGAGGATGACAGTGACCTCATTAAGAAG
TAGAATCCAGCTTACCACCTGCTTGTTACTCTGCCACTTGTATTGTTTCTATGTTTGTTT
CTCTTACATTGCTATAAGATTCATCTTCTGGTTTGCAAGTCATTTACTTGGCCTCCCTTA
GTCAGTGGTGGTGACTTCCTTTTGATAAAAGGTAAAAGTGTAACTTCAAAAACATAAACT
CATAAAAGGGCAAGGAGAAGAAATCTTGGCAGCTAAATTCTGAATACTAATAAATCAAGT
GATTCAGCAAAATTGAAAGGATTCATTTTCTTAGAGAAATTAAGACTTAACCCAAATTGT
ATTGCAGAACCACCAAAAACGCCAGAATTGATGGTACTTTCAAGTTACCTTGAAAGTCAG
AGCAATTAAATCCACCACTTTCTGTCTCCTAAGTTGAAGATCCTTCTACTCTCTGGAAAA
GATAAAACCATAACTGCTCTGGGGAATGCTGTTGACAGTGAAAGTTGAGGTATTATACTT
AAAATGGGGAGAAATGAAAAGCATACGTGGTGAATATCTAGACCTTTCCAGTTCTCTTTC
CTTACTCAAGTCCCAGGATCTTATTAGCCAGACCCTTAACACTAAACAGAAAGATTTTTT
GGAGATGAGGAATCTGATGACCAGTAGCAAAGGACCTAAATATGCTGCTGACTAAAACAT
GTGCATGAAAACCCAAACACAAACACACTTAGATGAAAATTCCAATTAGTTGTTTAATGT
TCTTATTTTGAAGTATGAACAGACATCAGGGATCATCAAACTCTTATCAGAAGATTTCAA
GAAAACAAGTACCTTTGACAAATCCAAGATTAAAGAGAAAAATTGAGCTCACGGAGTATG
ATTTACATTAATAATAAATGAAAAAGTTCCCTCTCTAAAACAAGTAATAGATGCTTTCAG
CTCTCTGTGTCCTCTTATCCTTCAGTTCAGTATCTGCATATTTGGCCAGCTTCAGATAAA
ATTCATCTATACTGAACGTATACATAATTCTTGTTATTCTCTTAAACATACAGTATATAA
CAACTATTTATGTAGTGTTTACGTTGTGTTTGGTATTTTAAGTATTCTAGAGTTGCTTGT
AAAATATACATGAAGAGGGGCCAGCACTGTGGCGCAGTGGGTTAACGCCGTGGCCTGAAG
CGCCGGCATCCCGTATGGGCGCTGGTTCGAGACCCAGCTGCTCCACTTCTGATTCAGCTC
TCTGCTGTGGCCTGGAAAAGCAGCAGAGGATGGCCCAAGTGCTTGGGCCCCTGCACCCGC
ATGGGAGACCCAGAAGAAGCTCCCGGCTCCTGGCTTCGGATTGGCGCAGCTCCAGCCATT
GTGGCCATTTGGGGAGTGAACCATCAGATGGAAGACCTCTCTCTCTGCCTCTCCTCTTGC
TGTGTAATTCTGACTTTCAAATAATTAAATAAATATTTAAAAAATATATATACATGAAGA
GGTGCATAGTTAATATGCAGAAACCATGCTATTTTATATAAAGAACTTGTACCTTGGTGA
ATTTTGTTACCCACTGATGTCCTGGAACTGATCACCTGGATACTGAGGGGGCCTGTGTAT
TCTGTTTTAAAAGAGGCCACCTTAATTGAATGGAAGTATTTTTTAGGAAATGGAAATTTT
TTTATTTTATTTTTTATTTTTTTTTTTTCATTTTTGACAGGCAGAGTGGACAGTGAGAGA
GAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCAATGGCTGCCGCAGC
CGGCGCGCCGCGGCCGGCGCACCGCGCTGATCCGATGGCAGGAGCCAGGAGCCAGGTGCT
TTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCC
CTGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGCCCCC
ACCGGGACTAGAACCCGGTGTGCCGGCGCCGCAAGGCGGAGGATTAGCCTAGTGAGCCGC
GGCGCCGGCCAGGAAATGGAAATTTTTTAGCAACACAGATGGTACCTCACTAATGGTGGT
TCAACTTACAGATGTTCCACTTAATGATGGGTTTTTCAGGATATTAAATAAATTTTTGAC
TTAGAATATTTTTGACTTGAATTTATTTAAACATAAAGCCATTATCACAGTCAAGGAACA
TCTGTACAGATAAAAATATCAGAGAAGTTGAGAAATGTAATTGACTAAAATCTTCCAGAA
AACAGTGAAAAGACAGGTTAGAAAATGGGAGTAAAATAAAATTAGGGATTTGGTACAAAA
TGTCCAGTATTCCAGTAATATTTTCAGAGAATGTGGAGAGAAAGAAATTAATATAATAAT
CANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCCAAG
TAGTCAGACTATCCTCTACTGCTTTCCCAGGCACATTAGCAGGGAGCTGGATCAGAATTG
GAGCAGCTGGTCTTGAACTGGCACCCATGTGGGATGCCTGCATCATAGGTTTAACCTGCT
GTGCCACAATGACCGCCCCCAAAACTTTACCTGTTAAACCTCCTTTCTTAAAGGGAGTTG
GCAGACATTTTCCACTAAAATGTGAGAAGGCATGAGGAAACAGGAAACGTGACATTCAGT
TCAACAACGAGTAAGGAATTCATCACGACAGTGGTGGAGGGAGATCCCAGTATGAAGCTG
CCTGCCAAACAAGGGAACAATCTGCTCTGGTTGCAACAGGACATAATGCTTTGACAGAGA
TTTACAATTAAATGTTTTAAATCTCCTCTCCATGGACAATCGAGAGAAGGGCTCAGTGAT
GAGTTAGTAATAAATATAAAGAGAAATAAGCAAAACAGAAAACAGCAAGAAAGGAAAAAA
AACATAGTATGTACAATACTGCTTAAGTGTAATAACATTTACACCATAATGTAAACACTG
AAATTGATCTAAGTAAAAAATAAATGCTAAGTAATTTACATTTGTGTAGGATATATGTGT
TTATTGATTTGTTGTAATTGAGAAAAGCCAAGTTGAAGTATGAGTCAAGTTTTGCTTAAT
ATTGTAGTGGAAGTAAATTCAGACATTTCGTGTACTTTTTCTTGTAGTTGTGTAAAAAAC
AGTTTCAGTACAGTGCCTCCTTACGAGCGCATCTTATTCGACATACCAGAAAAGATGCAC
CCACGTCATCGTCATCCAATTCCACATCTAATGAGGCATCAGGAACATCAGCTGAGAAAG
GCAGAACCAAACGAGAATTTATATGCTCCATATGTGGAAGGACATTACCTAAATTATATT
CACTTCGAATACATATGTTAAAGCACACAGGCGTAAAGCCACATGCATGCCAGGTAAGGC
CCAATCCTGGTCGTTGTGGGCATTTTGGGTGTGAACCAGTGGATGGGAGTTCTCATCTCC
TCAAACAAATTGTCTTTTTTACAGTCATAATGTTTACTTGGTGGTTTAAGGAAGGCTGGG
GCTTAACCATGGTGTGTTGAAACTGATTGCTATATATTCTGGGGTTACCTTCACTCTTGT
TGAAATGGCAGGGGAATTTATAACTTCAAGTTTCTTGCCTGTATCACAGGTGATTCCCTC
TGGCATTCTTTAATTTGCTGTCTGAAGTTGTTGTTAGAGAAGAATCTGTTTAGGATGTTT
GTTGAGAATAGAATTTAGGGGAATGGGATGAACCTTTTTGTATCTTTCACCCTACTTCTT
TAGTGGGGGCTCATTGTCAAATATGTGTTAGGTATAATATCACTCACTGCTCAGCCCCTC
CCCCCAGTTATTTTGAAGCCAAGTCTTAAGCATCATTTTATTCGTAAGTTAGATATCAAG
TATTACAGTGTACACTACTCAAAATGTGCATTCTGGGGCAAGCAGTTGTGCACACCAGTA
AAGATGCTACTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGA
TACTGAGGGGCCTGTGTATTCTGTTTTAAAAGGGCGCGCTACCTTAATTGAATGGAAGTA
TTTTTTAGGAAATGGAAATTTTTTTATTTTATTTTTTATTTTTTTTTTTTCATTTTTGAC
AGGCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTC
ACCCTCCAATGGCTGCCGCAGCCGGCGCGCCGCGGCCGGCGCACCGCGCTGATCCGATGG
CAGGAGCCAGGAGCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACTT
GGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAAC
CGGGACAGAATCCGGCGCCCCCACCAGGACTAGAACCCGGTGTGCCGGCGCCGCAAGGCG
GAGGATTAGCCTAGTGAGCCGCGGCGCCGGCCAGGAAATGGAAATTTTTTAGCAACACAG
ATGGTACCTCACTAATGGTGGTTCAACTTACAGATGTTCCACTTAATGATGGGTTTTTCA
GGATATTAAATAAATTTTTGACTTAGAATATTTTTGACTTGAATTTATTTAAACATAAAG
CCATTATCACAGTCAAGGAACATCTGTACAGATAAAAATATCAGAGAAGTTGAGAAATGT
AATTGACTAAAATCTTCCAGAAAACAGTGAAAAGACAGGTTAGAAAATGGGAGTAAAATA
AAATTAGGGATTTGGTACAAAATGTCCAGTATTCCAGTAATATTTTCAGAGAATGTGGAG
AGAAAGAAATTAATATAATAATCAAAAAAATTTCAAAACTATAGTATTGAAGTTTTCATG
TTAGGGGCCTGCATTGTGGTACAGCAGGTTAAGCCCCTGCCTTATATGCAGGCATCCCAT
GTGAGTATCAGTTGGAGTCTGACTGCCCCACTTCTGAACCAGTCCCTGCTAATGTGCCTG
GGAAGACAGTGGAAGATGACATAGTTACTTGGGTCCCTACCACCCATGTGGGAGACCCTG
GTGGAGTTCCAGTCTTCTGGCTTCAGCCTGGCCCAGCCCTGGTGTTGTGGTCATGTGGGG
ACTGACCTAGCAGATAGAAGATTTCTCTTTCTGTTTGTCTCTCTGCCTCTGTTGCAAAAT
TTCAGAATCTGGGACAAAGAGACAAAGGTCTTCTATCTGCTGGTTCACTGTCTGGATGAC
TGCAATGGCGAGGGCTGGGCAGTCCAAACCCACGAGCTTCAACCAGGTCTCCCATATGGA
TGACAAGGGCCCAAATACTTGGGGCCATCTTCTTCGGCTTTTCCCGGGCCATTAGCAGGG
AGCTGGATTGGAAGGAGAGGAGCCAGGACACAAATTGTCACCCATATAGGATACCAGTAT
CACAGGTGGTGGCATAACCAACACCTGCTCTGAGAAAATCTTGTAAATAGAGAGGAAAAG
GATCAGAATGGCTTTTGGCTTTTTAGCAACAGTGAAGGGATATGTTTCTAAGTTGAAATA
TATAACCAGTCAAACTATCAGTTATTTATGATGGTGGAATGCCAGTGTTTGAGATATGCA
TGCATGGTCTCAAGAACTTTATCCTTTTTTTTTTTTTTTTTTTTTTTTGTAAAAGATTTG
TTTGAAAGGCAGAGTTAACAGAGAGATTGTGAGAAAGGGAGGAAACAAGGGAGAGAGAGA
ACTTCAGTCCACTGGTTCACTCCCCAGATGGCCACACTGGCCAGGACTGGGCCAGGCTGA
AGCCAGGAGCCTGAAGTTTCTTCTGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAGAAGGGACAAACACTGTGGCATAGT
GGGTTCACTACTTAGAATGCACATATCCTATATCAGAGTGAGGGGGACAAATGGGCTTCT
GATCCAGCTTCCTACTAATGGCATAGGAGGCAATCCATGGTGACCCAAGTACTTGGGTTC
CTACCACCCACGTGGGAGACTAGACAGAGTTCCTGGCTCCTGACTTCTATCTGGCTCAGC
CCTGGCTGTTATGGGTATCTGGGGAGTGAACCAGAAAATGGAAGATGTCTCTCTCTCTCT
TTCTCTCTTTCTCTTTCTCTCTCTCTCTCTCTCTTTCTCTCTTTCTCTTTCTCTCTCTCT
CTCTCTCTCCCCTTCTCTGTCACTCTGCCTTTCTTTTAAATAAATAACTCTAAAAAGCAC
AGCTGAAAAAAAATCAGTAAGAGCTAATAAAGACAATCAACAAAATAAACTTAATATTTA
TAAAAGTGTTCACTTAAAATGAACATCGTTTCCATATGTGAATAGAATATTTACCAAGAT
TGAATCTATGCTGCCTCAAAAAACTTCAACACATTTCCAAGAGTGAAATCATTCAGAGTA
TGTTCATTGACTACTGTGAAACTCAATTAGAAATCAATAATAGAAAATATCCTAAAATTC
ACAATTACTTGAAGTTAATCATTTCTAAATAACTCATGAGTCAAAGAGAAAAATCATAAA
GGAAATTTTAAAGGCTTTTGAATTCAATGTTGAGATGTAACTAAAGCAATTTTTAAGAGA
AAAGTAGAGTTTTGAATTCAATGTTAGGAAGGAAGGTGGAAAAATCAGTGGTCTGAAGTT
TTACCTCAAAAATTGTGGGTGAAAAGGGCAGTAAATCTCAAAAGAGTGAAAGAAATGAAA
TAAAGACACAAATAATGAAATGGGGGAGGCCAGCGCTGTGGCGTAGTGGTAAAGCCCACC
GGCTGGCAGTCCCAGCCATCCTGTAGGGGTGCCAGTTCAGTTCCCGGGTTGCTCCAACTT
TCCGATCCAGGTTCTCGGCTATGGCCTGGGGAAAACCAGTGGGAGGATGCCCCAGGTCTT
GGGCCCCTGCACCCACGGGGGAGACCGGGAGGAGGCTCCGGGTTTCTGGATGGAATCCAG
CCCAATTCGGGCCATTACACCCTTCTGAGAGGTGACCCAGCGGATGAAAGACCCCCCCCC
CCCCCCCCCCGCCTCTGCCTCTCTGTAATTCTGCCTTTCAAATAAATTAATAAATCTGAA
ATAAGGGGAACAAATGTATAGTTATGAAAGATGAAACGGTAAACATGTAGAAAGAAACTC
CTCAATTTGACATGTGTGACATTTTTAAAGTACTGAATCAGAGGAGGGTTCACTTAGCTA
ACATCATTTGGCATTTGTGGCTTTGATTTTTATTTTGTCATTTATAATGTAAATTAAATA
ACATTTTTATTTAATATCCTAGTTTCTCTGTCCTCATTCTTCAGGCACAGCACCCATCTC
TTTGTGTTTTACTGATGTAAACACCTCTGTCTTTCTTAGGTTTGTGGAAAGACTTTTATC
TACAAGCATGGTCTAAAATTACACCAAAGTCTACATCAGTCACAAAAGCAGTTCCAGTGT
GAACTTTGCGTTAAGTCATTCGTGACCAAACGTAGTCTTCAAGAACATAAGAGTATTCAC
ACAGGTAATGAGAAATTTATATTGACATAATTACTTATTTGAAGTGATACACAAAAATTA
TAGGGTACCTGGTGGTATCTTGGTACATGTATACATTGTATAATGTTCAAATAGGATAAA
GAGATCTGCCTCTTCATATACATCTTTTGATAAAAATCAAAATCCTTTCTTTTTCTTCTT
TTCTAAAAAAATATGCAGTACATTACTGCATATAGACAACTTGCTGTGGTACATTTTTAC
ATCATTATTTTACTATTGATTATGTTGTAATTATATCAAATTAGATATAGTGATGGTTAT
GATATTGATATACTGTGTGTACAATTTTTTAATTGATGAAACTAAACTTTTAGAGCTTTC
TTACATATAGAAAAAATACTTCTAAGTTGTGCATAATTGAGATCCAGACATCTAAAGAAA
TGGTCATTGTTTTACTTATTTATTAGTATACAGGCAAAATGAGAGACAGATAGGTGTTTC
ATTGCTGGTTCACTCCCCAAATGGCCTTAATTGCTATGACTAGGTCAGGCAAAATCCAGG
AGCCTGGAACTTCATCTTGGTCTCCCATATGGGTGGCAGGGGCCCGAGTATTTGGGCTGT
CTTTTGCTGCTTTCTCAGGAGCATTAGCAGGAAGCTGGATTGGAAGTGGAACAGCTGGGA
TTTAAACCAGCACTCATAGGATGCTGGCACTGGAAGTGGTGACTTCATCTGCTACGCTAC
AACGCTAGCCCCAAGAAATGGTCATTGTTTTAAAAAGAGAAACGATGCGGCAGATGTGAA
TGTCACCATGGTAAATGGCTTATAATTTCATTAGAAATTTTAGTCCATGTATACTTGCTT
TCAGATGCTTTAAAGCAGGAATGTAGGAACGGCTGATGAAAGGTAGATACTTGGTCTAGA
GTTTATATGCAACTTTGTTACTATTGTAATCTATTGCTTATCAAGTTTGCCATATTGTCT
CGCTTAGGTAGCCTTTGCTAGTCCTATGGTTGTGGAGAGGAAATATGGGTTTGATATAGT
GGGTTCTTGGAAGATATCTGCCAAATGCTGTGCCTTCTGTGTCTCCTTATAGAATAACTT
CCAAAATATGACACAGAGAATTTTGTTGGAAGAGGATTTGATTGTTGAATTGTGGCATGG
TTTCTCTTTTTTATAGGTGAGTCCAAGTACCTTTGCTCAGTCTGTGGAAAGTCTTTTCAT
AGAGGCTCTGGACTCAGCAAGCACTTAAAGAAACATCAGCCAAAGCCTGAGGTTCGAGGC
TATCATTGTACTCAGTAAGTATTTAAATATCTGAATCATTCAAATGCTTTCATTATGTTC
TTAGTTTATTTGAAAGTTATTTTCAAAAGAAAATATTTGAAGATAATATTAACCTCTAGT
TTCAGCTTACTCATGATTTTAGTCAGTTTTGTGTTTTGTTTCTTTTTTGTTTTTGGCTGA
GGTGTATTATTTGCCCAAAACTTAATTCCTGGCCCCAAGTGGCTGTGGTTAATATGTTTG
CCTCTAAATGTTTTCATCAAACTCACTACCTCCAACCCTAAGCTCTAGGAGATAGAGGAG
AAATAAAGGTTAAGAGTAACTCTTCCAGAAAGCCACCAGATAGGCCAGATAGGGCAGAAT
GACCAAGAAGTCCTTACAGTGCTAGGAATCGATATTGGAAATGCAGGCTGTTGTCTTTAA
GGCTAATGCTGAGCTCTCAGGCCCAGGGAAACTTGAAAAAGCCATAAAACTCTCTACCAG
AGATTCAGCAGTTTTTTGTTGTGTGTTTGTTTGTTTGTTTGTTTGTTTTTGATAAAACAT
TTGCCTGGTCATTGTAAACTTCAACTTCTTAAAATTCCCAGTGAAAGTTGATTCTGATAG
TTTGCCAGTCTGTAGACTGTTTTTGTGAGGGCTGTCTTCCATCCACTGTTTCACTCCCCA
GTTGGCCACAATGGCCGGAGATGCGCTAATCCGAAGCCAGGAGCTTCTTATGGGTCTTCC
ATGTGGATGCAGGGCTCAAGCACTTGGGCTATCCTCTACTGCCTTCCCATGCTATAGCAG
AGAGCTGGATCAGAAGAGGAGCAGCCAGGACTTGAACTAGCTCTCATATGCGATGTCGAC
ACTGAAGCCGGTGGCCTTACCTGCTACGCCACAGTGCTGGGCCCTATTAGTACTTTTTTT
TTTTTTTTAAGTGAAAGAAAACCCTACCAAGACTTTTTTTTTTAATAAAGAGTTATTTAT
TTATTTATTTATTTATTTGAAAGGCAAAATTACAGAGAAGCAGAGAGAGAGAGAGGTTCT
CCATCAAACTAGTGCCCACATGGGATGCTGGCACTACAGGCAGTGGCTTTACCCTCTGTG
CTACAGCGCCGACCCCACAAAGCTGTCTTGAATGAAAGATAAAGTCTAAATGTCTGAGTA
GTTGAATGTAAATTGCATTTCAATTCTTTAGCACTTGGTTTCTCTCAGGCTTCATATGGA
CAGAGCAATGGCAATGGTTTCAGCCCCATATCCTCTCACCTCCCAAATTGTCAGGCTTTT
CTTCTGGTGATTTCTATGAACCCTGAGGTTTAAATCAAGTTAAATCATTCAGATATCCCT
GAGTCAATCAGTGTGACAGGTGATTGCCTTGTTCTGATTGGCTTTGGCCTGAGTCACTGT
TCCATTCCTACTGTCAATGGTGAAGCTAACCCTCAACACATGGCCAGAGAATGAGAAAGC
AGATGAATAGGATGTAAAGAGGAAGATCAGATGCAAGAGGAAGAGAGATGGGCACAAAAT
TCCCTCTATAAGATTCTGGGACTCTCCATGAGTGTTTTCTAAAAACATTTCTAGTGCTGC
AGAGATAAACTAATTTACAGTCCTGCAACCGTGATGTAAGATTGGAATGACTGGGAGATT
TTTTGTTTTATATTGAGATCTAGGAACCTTAAGAATATACTGAATCCTTAGAAATTTGTT
TTAAAGAAATAAAGATGATCCATTTGGGTAATTGAACTTTATTACAGATGTGAAAAAAAG
TTTCTTTGAAGCTAGAGATCTTCGCCAGCACATGAACAAACATCTTGGTGTGAAGCCATT
CCAGTGCCAATTTTGTGACAAGTGCTATAGTTGGAAAAAAGATTGGTATTCCCATGTGAA
GTCTCATTCTGTCACTGAGCCTTACAGGTGGGTGAATTTGAGAAAGATCTGAACTTAATT
GAGATATACATTGAGACACATACACATATATGTACTTCAACTGCTCTTATGGCTGGTAGT
GGTTTACAAAACAAAATTTAGGTCTTTTCTCCTGTTTTAGGTGTAATATATGTGGAAAAG
AGTTTTATGAAAAAGCTTTGTTCAGAAGGCATGTAAAGAAAGCTACCCATGGGAAAAAAG
GAAGAGCAAAGCAAAACCTGGAACGAGTATGTGAACAGTGTGGGAGAAAATTCACTCAGC
TGAGAGAGTATAGGAGACACATGAACAACCATGAAGGTAACTACGCTTATTTTATGTATG
TGTAATGTTCTATAAAAAGAAATCTAGTAGTGACTTTTTTCCTTCATCAGCCCTGTTGCC
TATTATCCCACTTTCATCAGTAAGAACTTAATCCCAAATCTTGAAAGATATATTCAAGTG
ACAGAGCTGATTGTAAACCCAAGTACCTTAATTATTTATAAAGATGGATTCCTTTTTTAG
TGAGCATAATTTTATATCAACATTGTTAGACTGAACTAAATTTGAAGGCTCTGTTTGCTT
ATCCTAGGATTATAGGATAGCTTTGATGAAAAAAATGAGATTATACTTGCAGACTCAAAT
TTATCTGTTCGTACAACATATGACATCTTTCGAGATTATGGTGCCGGACCTTTATTCTAA
GGGCAAGCTTTGTCCTAAATGAGAGATTGCCATAGTGAAAATAGAATGGCTGATGTATGC
TGTACTTTTAAAAAAAATTATTTTAAATACATTGGTACTTGTACCTCATCACACACACAT
ACCCCACTTTTTGTTTTATTATTATTATTTTTTTTCCGTAGGAGTTAAACCATTTGAGTG
CTTAACATGTGGAGTAGCTTGGGCTGATGCCCGATCTCTCAAACGCCACGTCAGAACACA
TACTGGTGAACGGCCCTATGTCTGTCCTGTATGTAGTGAAGCCTACATAGATGCTCGGAC
ACTCCGTAAACATATGACTAAATTCCACAGAGACTATGTGCCTTGCAAAATTATGCTGGA
AAAAGATACCCTTCAGTTTCATAACCAAGGAACTCAAGTGGAACATGCTGTTAGTATCTT
AACAACAGACATGCAGGAACAGGAAAGTAGTGGTCCTCAAGAACTTGAGACTGTAGTGGT
GACAGGAGAAACAATGGAAGCTCTCGAAGCAGTTGCAGCCACCGAAGAGTGTCCATCAGT
ATCTACACTTTCTGACCAAAGTATTATGCAAGTAGTTAATTATGTATTGGCACAACAGCA
GGGACAGAAGCTCTCTGAAGTTGCAGAAGCTATTCAAACTGTGGAAGTAGAGGTAGCACA
TATTTCAGAAGCAGAATGAATATAGTTATGAAAATGAAAGGAAGAGACATCTCATATACT
AAACTCACAGAACATTTGTTTACAATACCATGTGACTGTCTGCTTAGAGTTGATATGTCA
AGGCTCTGGGCTTAGTGATGTAACAATCTGAACACTGTCCAGTGGGTTCTATAGGAAAAG
TCCATTTTCTCTAAAGAAATTGAAAAAAAATCTACTTAATGGCAGTGGTTTATCATGGTA
TACCTTTTGTGGATTAATGTTTATAAATGTACTAAATTGGAAGCTGTACAGTTTCATTTG
CATTTTGGCATTGTTTCATTATATATTTTGAGTTGAAAAGGTTGGACCTTTGGTTTTTCT
TCTCAAAATATAGAGGTTCTGTGATTTCACTCACACTGTTTATGGATTAAAAAGAAAAAA
TATAAAGCATTTCAATAGGATTTATAGATATGTTACGGTTTTTTTAAATGCTTTACATCT
GTGATTCTTGGCTTACTATTTATTTTTAACCCCTTCTAAGTCAGGGATTCTTTATTTTGT
TTTAAAGCACTTAATGAGTTACATGTTGTAATCAAGTTTGCACAATATATTTATCTATAT
GGGGAACCCATAAATGAATAGCTACTTTTTAAAATGCCATTAAAATGCATGAAATGCCTA
TTGAAGCCTTACTGTACTATCTTTTCAAGGCAAGTAAACTTACCATGAGAAAGAATATTG
TTATTAAACACTGTTCATGGAAAATTTCTCCTTGATACATAGGAAAATGTGTGAAAGAGG
GGGAAGAAAAGGATCTCATTCTTTCATTGAAGAATGAACAAGTTAGTTTTTCTATGTTTT
CAGCTTTTGTATCATGTTTAATTGTTTAATTTTGTTTGAAAACTGCAGTAGAGAGTATCT
GCAGTGGCCCTGTGAATACTGTATTAATTGTCAAATAATTTCAGAATATTCAGTGCAGTG
CTCATTACAATATACTACTTGAAGAAATTGATTATGATCCCACCAAATTGTTGAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1310, 8938..9010, 9012..9023, 9025..9074, 9076..9176, 10163..10394, 23676..24520, 24734..24910, 28967..29212, 34119..34263, 35462..35463, 35466..35533, 37247..37257, 37259..37406, 37540..37715, 38261..38778
1001..1310, 8938..9010, 9012..9023, 9025..9074, 9076..9176, 10163..10394, 23676..24520, 24734..24910, 28967..29212, 34119..34263, 35462..35463, 35466..35533, 37247..37257, 37259..37406, 37540..37715, 38261..38775
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved