Oryctolagus_cuniculus Locus ENSOCUG00000000746
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000000746
Oryctolagus_cuniculus
ENSOCUG00000000746
GeneScaffold_5759
SNORD58
1215..1280
2946
GCACCGTTCTTACAAGGTGGCTGCAGTGATGCTTTTCTTAGGACACCTTTGGAGTTAGC
CGTGAAATAACCAATCAGTTCTGAGCGGCCATCTTTGATTTGAGTATTGATCATCCGGGT
ATCCTGAGCAACGTTATTTAGGATTTGTGGGAAAGCAGTCTGCAGCTCGAGGTGGGACTT
AGAATTACGTCCAAGATGACCGGGTCTGAACGTTTCATAGCAGGCAGGGGTTTAGGGCTG
CTTCCCCCTCAGCCACAGGGTGGTTGACATTGGACTACCTCACCTCCCAAGAATGGAGAA
GGGTGGTTTTTTAACTGCTGGTCCGTGTTGACATTTTGACAGTATGCAGATTGCTTGCTT
AAGTATGATTTGACATAAATGACAAATATTTGTGTTCATACTTAGAACACTCGAGAAACT
GCCCAGGCCATCAAGGGTATGCATATCCGAAAAGCCACCAAATACCTGAAAGACGTCACG
TTAAAGAAGCAGTGTGTGCCATTCCGTCGGTACAATGGTGGAGTTGGTAGATGTGCCCAG
GTAAGAATTCGTAGTTCCATAACTGCAGGGAAACCTGAGATGGAATGGCTAAGATGGGCC
TTTATCGTGCTGTTTCTGGTTGCTGTGATGACAAATCTTAGGACACCTTTGGATTAACCG
TGAAATAAAACACGTTCTGAGCAACCCTGATGTTGTAGCAAATACATTCATCTTGTTTGC
AGTGTTAATTTAAAGAAGTCACTGATTATCTCTTTTCATTTTCTTTCAGGCCAAGCAGTG
GGGTTGGACCCAGGGTCGTTGGCCCAAAAAAAGTGCCGAGTTTCTGCTGCACATGCTTAA
AAATGCAGAGAGTAATGCTGAGCTGAAGGTATCTAGGCTGTTGGCATTCTTAAACTTGTA
AATATGTGCTAATGACACTGATATCTTGATTGATTATCTTTCTCAATAACAGCCTTTTCA
TTTACTAAAATCTCTACCTCCTGCCTCTGGCACGCCATAAAGACTCAGTCTGCCCATGCC
TAAGACTTAATTACTAGTATTTCCCTTATTGAGGTACTTGGAAAAGAAACACTTCTGCCT
TCTGTCTTTTATATTGCTGGTATTTCACTAGGAGTTCATTGTGAAGTGGGTTTTTGGTAG
TAAGTCAACAAAAGGATCGGGTTGATGGTGGTTAATGTGGTATGTTAGAGTTATAATGAA
GGGAATGTTAAACTTCAGAAGTTAAAACAGTGATGGTGGACAAAACACCAGGGTTTATCC
TTTACTGTTCTGCATTTGAAAGCCTAGATCAGAACTGGAGTTCTGTGTAAAGTCAGTGCT
TAGAGGTGCCTCTGCTTTGTGCTCAGCTCCTGTTGAACCACCTTTAGGGAGGCTGCTTAA
AGTTGTGGCCTGTAAAAGCGAAAGCAGACACAGTGTAAATGATTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCATCGAGATGATCCTCACTGAGAAGGAACAGATAGTGTC
CTAAGCCAGAAGAGGAGGTGGCACAAAAGAAAAAGGTAAACCACTTAGTGGTTCTCTGTC
CAGTTGAGGGCAGATTTGGGGTTGCTGTGATGGCTATCTTAGGACACCTTTGGAATAACC
GTGAAAGGAAATTGTTCTGAGCAACCCGTTCAGCCAGTTTTATCATTCATTTTTAATATA
CTTGCTTGACTTGCTTGACTAACAGCAAGGTTGTGATTGGTAAAGTACATCAGACCCCCG
TGATTTGCCTATGGAGGCACAGCCACTTCAGACAGGGCAGGCTAAGCCACGCCCCATACT
CCACACCTAATGGATGGAGCATGCTGCTTATCAAGGAAATACCCGCCATCCTTTCTCCGC
CTTAGTCCTTATCTGCCAGGCTTCCTGCCGCCTCTGTTAAGCATAAACTTTAAGTCCTCC
AAGAATTTAACAGTCCTTTTGTTTTTTCTCTCCCCAGATATCCCAGAAGAAACTAAAGAA
GCAAAAGCTTATGGCTCGGGAATAAACTCAGTATAAAATAAATACGAATTAAAAGAACGT
TGGTTGTCTTTATTAGTAAACCTTTTATGTCTTCATAAACGCATCAAATGAGTTCTCTTA
GGATCAGAACTCAAATCCGATTTTGGTGTGCCCCCTGCCACTCAGTGTTGATCCGTGCAT
ATGCTGCTGTGAGGCTCTTGAATATGGGGGGTCTTGTCAGCAACTTTGGGATGTAGCACA
CTTTTCAGTTTACCCAAGTACAACGCAAGCCCTTGTGCCGTATTTAGTGCATGTGTTGCA
AGTTTTCTTCACCCTGAGAAGGAAGGCTGCGGTTGTTAGTGGTCACTCTCCAATCACTTG
CCTGTTTTCTGGTAATAGATTAACAGTGTTTGGTTAAGATGGGGACCTGACCCGTGTCTC
AGGCCTTCATAGCATGCCGTGGGTTATGCCACAGTGTTCTAGCCGCCAGGCATCCCTGGG
TCCCGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 1365..1463, 2220..2315, 2516..2542
1001..1135, 1365..1463, 2220..2315, 2516..2542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved