Oryctolagus_cuniculus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus TOMM20
Oryctolagus_cuniculus
TOMM20
GeneScaffold_5556
SNORA14
1527..1661
8330
GCAGGAACAGGCCCTTTTAAAACTTTGCCTGAGGGCGGGCAGGGAAGCAGGAGCAACGA
ATCCCATTAGGATGGGGGTGGAGCCTGGCTCAGGTAGCTGGGCCATGCGGCCACCTGGCT
AAAACTGCTATGTGTAATAGGTGTAAGAAAAAACATTTTGTTTTCTCTGTTGCATGAAAT
CAGAACACTTGCTTTGGTACATCTGCACCATCACACAAGCCCTTGGTTTAATTTTTAGCC
TTCTTCAGTATCTCAGGCTCATCCTCACGGACTCAGGCCTAAGTGCTACACTTAGGCAGT
TTTAAATGGCAAAAAAGGTGCAAATCAGAACCAAAGAAGCGAAACCCTCCCCAGCACACA
GCACATGAATGTGTGACCACACAGTATTGCCAGGCTGGGAAGGCCACTGCGCTGGTGTCC
AGGTTTTTAGTTGAAAGGCAAACTGCCTGACACACACACACACAGCTGTTCCACTCCCCA
GATGTCTGCAACAGCGAGGGCTGAGCCAGGCCAAAGCCAGGAGTACAGAACCCCACTTGG
GTCTCCCAGGTGCGTGGCAGGAACCCAACCACTTGAGCCACCCCATCCTGCCTCCCAAGG
TGTGCCTTTGCAGGAACCTGGAGCGGAAGCTGAGGTGCGCACAAGTGGGCCCTCCCAGAT
GGGATGCGCCCCTGTGCGCCGCAACAAAACCTCCCATTCCCGGGTTTGAGGGCAGTGCGT
AGTTCCGCTCGCCATCCCTCCACCTCTGAGCAAAGCCGGAAATGGCGGCGGCGTGGTCCG
CTGCGCAGGCGCGTCAGCAGCGCGACGCCGGCGCTCAGGCACTGCCTTGGACGTTCTCGG
GGGCCTCGGTCGACTGGGCCGGAAGTGGCTCGCGCTCGGTCTTTCCGCTTCCCTGGCCGG
CGGACGAGGGTCCAGAGCGGCGCCGTCCGCTCCAAGGGTTCGCGGCCAACCGTTGCTTCG
GAGGCCTCGCCGCTGCCATCACATTCTGCAGCTGAGAGACCATGGTGGGCCGGAACAGCG
CCATCGCCGCCGGCGTATGCGGGGCCCTTTTCATCGGGTATTGCATTTACTTCGACCGCA
AGAGACGGAGTGACCCCAACTTCAAGAACAGGTTGCGAGAACGTGAGTGTGTCCCCCTCG
CCCTTGGGCCCGCACCGCACCCTCGCGCTGCCCTGCCTCGCAGCCGCCGCCCTTCGCCTC
CGCGCGCTGAGCGACCGCGTGGTGTGGCCCGGAAGAGGCGATGGCGGCGTGACTCCCCGG
GCTCCCGGGGCTGGCGGGCCCGCGGGATTCTCTCCATTTTGTTTTTCTCAAACTCCTTCT
ACTGTGTAAATGCACTCCAGTTGGTATTAAAATTAAGGTTGGGGGATGGAGGATCTGGGA
ACTGGTGCGGGAGACGGAGGAGTGTTCCCTTTATTTTTTTGCTAGTCCTCTTTTAAAATA
GCTGTTAATGCGGAAGTCGAGCCTTTTTTATTTGACACATTTTATTTAGCCTGAAACTAA
GTCGGTAAATGTAGCGCTGTATCATTGTTGCATTCCTAAACCTTCTTGGTAGCTTCGCTG
AAAACGCTTCCAAGATATCAGTGAATGCTATAGAAATCGCAGGGGAGTCCAAAAGGCTGC
CCTTCTCCTGTGGATCAGTCTTATTTCATACCTGCGACATATTTTTTTTTTTAATAAGAT
TTGCAAGAAAGAAACAGTGTCACCAAAACCACAGCGACCCGCTTGGGTTTCGGAGGAATG
TTCTTTTGCAACAATCAAGAGTAAATTTGTCGCAATAAGAAATGTTTTTTGACTTGCCCG
GGTTGCTCAGTCAAAACAGTTTTTGAAGTTAAAATGTACATGTTCTGGACTTTATGAAAA
GTCCAGAGAAAGTACAAAGAAGTGATTATCCAGTTTAATGTTGTTTATTAAGCTATCCTA
GGTCCTTCAAGTGTTTCACGTGACCATCCATGCGATGATCTGATGTCATTTAAATGTAGT
TCTAGCTGTTTCCCTTTTAAGAGGAAAAAGATGTAATTTGCCTTATTTATAGTTAGACTA
ATGGAAGGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTACTGCTTTTGAAGACCCTAGCAGG
GAGCTGGATCCAAAGAGGAGCAGCCAGGACTAGCATAGCTGGAGGATTTAGCCCACTACA
CCACAGTGTAGAAGCCTCTCCAGCTTCTTTTAATGCAGATCCTGGGAGACAATGATGCTG
ACTTAAGTGACTGGGTCCCTGCCACCACGTGGAGACTTGAGAATTTTAATCTTACTGCTA
GAAATGTAAAGCATCCAAATGATCTTAAAATTGGTAACAATAGGGGCCAGTGCGGGTTAA
CGCCCTGGCCTGAAGTGCTGGCTCGAGATCTGGCTACTTCACTTCCGATCCAGCTCTCTG
CTATGGCCTGGGAAAGCAGTAGGAGATGGTCCAAGTCCTTGGGCCCCTGCACCCGCGTGG
GCGACCCGGAAGAAGCTCCTGGCTTCGGATTGGCACAGCTCCGGCCATTGCAGCCAATTG
AGGAGTGAACCATTGGATGGAAGACCTCTCTCTCTCTCTCTCTCTCTCTGCCTCTCTTCT
CTCTGTGTAACTCTGACTTTCAAATAAATAAATAGATCTTTTTTAAAAATTGATAACAAT
ATCAGTCAAATGTATATGCATTCAACAATTGTACTTCCTCCATATCCTATTAAAGTTTTG
TAAAGGCTGGATAGAAGTAGACCTAAGTTTCACTCTACTCAGGATTTCATTATTTTTGCC
ATTTTCACTAAATTCTGGCTTAATGAATTGCGTTTGTTATTGTTTAGTTCACAAGCTTCC
CCTGTTCATTTCTGAGATATCTTATTTTTAGAGGAATGTCTAACAGGGATGTCTTTATTT
CACTGTACTATTGAGTATGGAGGCAGAATAATACTTGAGTGCACAGGCTCTGAAATTCAT
CTGCCCAGGTTTGAATTGACACTCCATTGTGTACTAGTTGTGACCTAGATAAATGTTGTC
ATGTCTAGAATTAGGGGTGATAATATCTGTTTTATTATCTATTGATAATGTTGAAAATAG
TATCTGATCTGTAGCAACTAGAACTGAGTTCCTTTTTAAAATTACAAAAAAGATCATTTA
TTTGAGAAAGGGCTACTGAGAGCTCTCCTATCTTCTCATTCACTCCTCATTCACAGCCAA
GCTTGGGCTGGAGCTGGAGCTCAGAGTTGGGAATTCATTGCATGTTGCCCATGATGGTGG
CAGGGACACAACTGACTGAGTCATTGCCTGTTGTTCCAGGGGTCTGTATTCACAGGAAGC
GCGATCCCAGAATCAAACGCAGTTGTTTTAACCACTAGGCCTTGTGCCCACCCAAAAAAC
GACTTCTTAACATCCGAGTGTTTCTTGTCTTCGTGTCAGGTTCTTTCCTTAGTTGTGTCA
CAGTTATTTTCCATATCATTGGTAATACTCAGTGATTATTACTTTAGGTAGTTAGCATAA
AACAACCCTTACTGAGGGAATGACTCAATTTGAAATGCTTATTACACCGCGCCATGGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTGCCTGGTTCTTTGTGCCCCACAGTGCATACCCACCAGTACACATAGTGGGT
TTGTGTATAGGAGAGGAGCCCTGAATTTATGGAAACAATCTTTAAAAAGATGTTTGTGGT
TTGCCATAAATGTCGATTATATTCTGAATGAAACACAAATAGAGCCTTGTTCCAAATGGA
GATACTTTGTAATTCCAAAGATGTTCACCATACGTACTTCCTGAGAAGGATAATTTGAAG
CCAAGGCAGCAAATATCTCTGTTCAGAAATGGTACAGAACTGGGAGAGACTCACCTGTAT
CAGTATTTTAAATTTTTTAAAAGAATTTATTCAAAAGGCATAGTGATAGGGAGAGAGATC
TTCCATTTACTAGTTTACTCACCAAATGGTTGCAACAGTCCAGGCTGGGCCAGGTTGAAA
CCAGGAGCCTGGAACTTCATCCAGGACTTGCACATGGATAATGGGCCCAGGCACGTGGGC
CGTATTCTGCTTCCATGATGCGTTAGCAGGAAGCTGGATGGCTGGGAAGCGGAGTAGCTG
GGAATTGAACTGGCACTCTAGTATGGGATTTAGGAGTCCCAAGTGGCAGCTTAACCTTCT
GCTCTACAACACTGGCCCCTAATAGCACAAAATTTTATTCAGAAAATATTAGAATTTTTT
AGAATTTTATTTAAGGTAGAATCAACTCAGGACAAGGATCACATGACAGTTAATTGATAT
TTATTGAGTAAATCTTAAAAATCTGTAAGCCTTAATTTTTTCTTCCAAGAGTTATAAGAC
ACTATTAAAGAAAATTTATAGATAAAGCAAATAAATACTGTCAATTAGAGATCAATCACT
GTTTTGTTACCTGCTTCTTCCTGACATAGTTTTATCAAGGTGAACATTTTTCCAACTGGT
AGCATTTAAAATTTTTTTATTTCCGATGGCAGGAGCCAGGTACTTCTCCTGGTCTCCCAT
GGGGTGCAGGGCCCAAGTACTTGGGCCATCCTCCACTGCATTCCCTGGCCACAGCATTTT
TTATTTCCATGTGATAACATTGATTTGGTACAAATGGTTGGTTTAAAGCAAAATTGAGTA
AGTTTTCTACTCTGTCATCCATCTCCTAAGTTTGCTCTTTTCATAGAAAAGTACTTTTCA
GTTGTTCGTAATTTCTTAGTAATGCTTTTGGAAATACATTTCTACACTGTACTTTTCCCC
TTATGTATGTATGTAGATTGAGGGCATCTCCATATTAGAATATGTAATCTGACTCATTCT
TGATAATAGATTAATAATATTCAGATATATGAATACACTATAGATTATTTTCAGTTTTTT
ACTTACACAGGTTTTGTTCTGCATCACTTGGAGATGGTGTGAAAAGTTGAATTTTTTTGA
CAAAGGCGAAGGCTTTTCAGGGTTACAATTTTATATGAACCTTACAGGTGAATATGAAAA
GGGTGTTGACCATCTGACAAATGCAATTGCTGTATGTGGGCAGCACAGCAATTGTCTGCA
AGTTATTGCAACATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 5499..5545, 5646..5727, 7247..7302, 7305..7313, 7315..7323, 7325..7330
1001..1121, 5499..5545, 5646..5727, 7247..7302, 7305..7313, 7315..7323, 7325..7330
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved