Oryctolagus_cuniculus Locus Q9TRD6_RABIT
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Q9TRD6_RABIT
Oryctolagus_cuniculus
Q9TRD6_RABIT
GeneScaffold_3727
SNORA29, SNORA20
1559..1697, 5151..5284
7538
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGGGACC
ACCTCCGTGGTAGGTCGGCGGCCGGTAGCGGCCGCCCTCGGGTCGGGCTTTCACGATGGG
GCGATGGGAACGCGCTGACGTGTGATTGCCGAGCTGTGGCGCGCACGGGAGGTAGACAGG
TCTTGGTGCGGACGGTGTTAACTCTGACCAGGTCAGGGTGCTGTGCGGGGGAGATGTGTC
ACTAGGTGGGACGTCAGCCCCGACGGGATGCAGCCCACTTCCCCCGAGCAGCGAGGTGGG
CTTTGTCCCAGCAACCTGCTTAATACGACTTTTATTTTTTTTTAAACGATTCTTGGTTTC
TCATAAGAATGGTTAAGAACAAAAGGCCAGATGGCCCAAGGTAGCATGAATCCCTGAAAT
GTAAATGACAGGTTTTTAGTTCCTGCTGAGCACTTGATCTCTGAGGATGATGGGTGCGTC
CTGGCTGTGCCCTGCGGGACTCTGGCTCAGCCAGAACCCTGGGCAGCCTCCTCTCTGGTC
CAGGCGTTCGCAGTTCTTGTCCAGCTTCTAGGAACCAGCTGTTGGGTTCCCCAGCATTCC
CGCCGCCGTCTGGCTGATCCCTGACCATGGCAGTGCTTCTGCATCCGTGGTGGCAGACAT
CCGACGCGGCGTCGGCAGGGCCCTGTGTGTTTTCTCCGCAGGTCATCATCGCAGCAGAAC
TGCTGAAGAACGCGGACGAGCTGGTCAAGCAGAAAATCCACCCCACCTCAGTCATCAGTG
GCTACCGGCTTGCCTGCAAGTAAGATTGCGTACGCTCAGAGAGGGTGACGTTTTTTAAAA
TCCTGATTTGGACGGTAGAGTTAGGGAGGGGGGAGAGACAGCCTCCATCCGCTGGTTCAC
TCCCCGGATAGCTGCAGTGACCAGCGCTGTGCCAGGCCAAAGCCAGGAGCCTGGGTTTTC
TTCCAGGTCTCCTGTGTTGGTGCAGGGCCCCAGATACTTGCACCGTCTTCTGCTTTTCCC
AGGCACGCCAGCAGGGAGGCGGGTCCACATGAGCACCGGGTCTCCTGCGCCCGTATGCAA
TGCTAGCATCACACAGGCCCTGGAAAAACGTATTTGATGAACTGATAAACAGGTGTCTGT
TAATGTGTTGACTAGTGGCTAATTTTTTTTTCTTTATGACTAAATTTCAGTTTGAAAAAG
CTGCATTCTAGCACTTTAGCATTTATGCATGAAGTACACGGTGAAGCCAGTATCTTGCCT
TTCCCATTTGACTACCACGTTTTCTCCAATTAGTAGATTTCAGTGGCTATGCTTATGGGA
TAGATGAAAACTGCCATGATCTGAAGAGGGAGAGGATTTGGTACCCTCCTTCTATATGAA
ATGGCTGGACAGAAGATGGCCTGTGACAGTTGGATGCTATCCGAAATGTGATAAAACCAA
ACCCTTGAGTGGTGAATTGATCAGTGTTTCTCCCCACACTAAACAGGGAAGCGGTGCGCT
ATATCAGTGAAAACCTGATTATCAACACGGATGAACTCGGGAGAGATTGCCTGATTAACG
CTGCGAAGACGTCAATGTCTTCCAAAATCATCGGGATGTATCCTTGTGGTTGCCCAATAC
GGGTCAGCCGGTCTGTGCCCGTCATTGTGGAATAGTGCATATCAGTGCAAAATGAGGTTG
CAGCAGAGATGAGCGATGCTGGGAGTTGCCTGTTGCCTTCCCTGAATTTTTACAGTGAAA
AGATACATAAAGCGCGTATAAAAGTGATTGAATTGCAGATAGTGATAAGTAATATTGCAG
GATTTTGGTGGCAGAAATAATGCTTGTTTGATAAATAAGATTACCAAATGGGGGTCTCCT
CACATTACTTTTGATTTTCATGTGTACCCTGTGGTCATTCCAAATTTTGTGGTTACCCTT
AACTGTTGGCTTAGAAACGGAGATTTCTTCTCTAATATGGTGGTAGATGCCGTGCTTGCT
GTTAAATATACAGACGTACGAGGCCAGCCTCGCTACCCAGTCAACTCCATCAATATTCTG
AAAGCCCACGGGAGAAGCCAGACCGAGAGCATGCTCGTCAGTGGCTACGCTCTCAACTGT
GTGGTGGGATCTCAGGGTAAGGGGTGGGGTCTGCTCAGAGAATGGGGTGGACTTATCTGA
GTGGCAGGAGCGATGGAGATCTCACGTCTGCTGGCTTACTTGCCAGAGCAGAGGCCACAG
GAGCCAGGAACTCCATCCGGGTCTCTCACGTGGGTGGTAGGGGCCTAAGAACCAGGGACC
ATCTTGTGCTGCCTTCCCAGGCGCGCTAGCAGGGAGCTGGCGCTCTGATAGGGAATGCTG
GCTTTGCAGGCAGCAGCTTCCCTCCCTGCGCCACAACCCTGGCCCTTAAAACTGGCCCAT
CTGGGTTGTGCGCGTTGCGTGTTTTGTGGCTTACACACATGTAGCTTGTTAGGATGAGTG
CACATGGAAGAAATGCTGCTTGTTTGGTGCCATTGAACTGTTGAGATGAAATGTGAATTA
ATGCCTTCGTGACTCTTGGGGTCTGGGGTGAATGTGTGGTTGATGAGCAGCATTGTTATG
GTGACTGTAATGGAACTGAATATTCTGTTCAATTACAGGCATGCCCAAGAGAATAGTTAA
TGCAAAAATTGCTTGCCTAGACTTCAGCCTGCAGAAAACAAAAATGAAGCTCGGTGTACA
AGTGGTCATTACAGACCCTGAAAAATTGGACCAAATTAGGCAGAGGTATGTTGAGAGAAT
ATTTTTGGTCTTTGACAAGGATGTTTATAAATTATTGGACTAGGTGACAGTAAACTAAAA
GGAGTGCTGTGTCTGAGGTCATGGAGCTGGTTTAAGAACCATTTTTTAGGCAGTAGCATG
TGTTGTTGAACTGGAGTTTCTGAGTGTGAATATCTTGAAGGACTTTAACATTTCTAACAA
AGTCACACCGTTTTGCATAGTGTTAGATTAAAGTAGTTAATCCGTTGGGCCACAGCACCA
GCTCCTAGGTGGTGTAGCCTTAACTTTACACACCTGGACTACATCGTATTTATTTGGGCT
CTGATCAACAGAACAGTGCAGAGTTGAGCACGAGGGGAAACAGTAGTCGGCACACGGTGC
ACGAGCTGCTAGCATGACTCAGAAGTCTGCAGCCAGCAGTAGCAGGCGCCCACCCAGTAC
TAGGTCCTTCATTACCCTGTTATCCCTGGCAAGCGTGCTTGAATAGCTGGTGGGGAGCAG
CGTCCCTCAGCCACTGGGACCGACGTGCTGTGCTGCGTTCACAGCTGCTGTGGGCTCACG
GCAGTGGGGTGGTCCCAGCTGTTTTCTCTGGTACGGGCCCACTGTTGACCAGAGTGCAGT
TATGTAGTGGGCAGCACGCCTCTACTGCCCCAAGTCTTGTAGCTTCTGCACCACACCTGA
CCTCTTTGCAGACACTTCATGCTGGATTTGACTGATAGGGGGTTTCCTTGAAAATGCTCA
GCTTCTCAGCCACCTAACCCATAAAGCTCTTCGTTTTCTAGTCTGATCCGCAGGTCTACC
CAGGATCCCTTTCTAGACCTCCTTAGCTGGGTGTATGCCTGTGTCCATCTTCGCATACAA
CAATAGTTAATACTTGCTGGGGGAATGAACAGTAATTCCTCCCTCCAAGAGATCCTGAGG
GCAGGCTCCTTCGTATTTGGGGGAGGGGTATTTCAAAGGCAGAATGATGGCTTCCATCTG
CTTGTCCACCTCTTAAACACCTGCAAGAGCCAGAGCTATGCCAGGCTGAAGCCAGGAGCC
AGGAACTCCATCTAGACTCCTGCATGGTGACAGGGACCCGAGTGCATGGACCATCATCCT
CTGCCTTCCCATGTGCATCCGCAGGGAGCTGGGTCTGGAAGTGGAGCACCCAGAACAATC
TCCAATGCGGAGGCTGGGCTCGCAGGCAGCAGCTTGACTGCCCGCTCCACGACACCTGCC
CCACTGCCTCTTCCTAACCGCACCTCTAAATCAGGAACTCAGCTAGGGATTGTGGGAAGC
AAGTCGTCCTTTCCATTCCTTGAGCTTCCAAAAACTGGACTAATTTAAGTTCTAGATGTA
GATGGGAAAGAAGGGTTTCAATTTAATCTAGAGTGATTTTGTGAATGAATACTTAGCGAA
AGTTAGAGTTGTATTAAGAAAGAGAAGGTAATTTGGGGCACTAAAGTCCTTTTCTTTGTA
GAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCTTGGCGACTGGTGCCAATGTCA
TCCTCACCACCGGCGGCATTGATGACATGTGTCTCAAGTATTTTGTGGACGCTGGTGCAA
TGGCAGTTAGGAGAGTTTTAAAGAGGGATCTTAAGCGGATTGCTAAAGCTTCTGGAGGTA
AGTCTTCTGCCAGCCGTCAGGTGGAGTCCCGGTGCCTGCCACGATGGCCTGTTTGTGTCG
GGACACTGTGCTGAGCAGCTCCGGGGACACCATCCTTGTAATGGTTGTGCTGCAGACAGG
AGTGCCTGCCTGTTCACGAACTGGGGAAGTCTGCAACCCTGGGGATGTATTAGCTTACTC
TGTTCATCTCAGTGACACCTTGACCTCACGGTGTCACTTTTATCATAAGTTAATGTTCTG
AATTTACGACGAGGTCATCATGAACATTATTTACACCTTTATGACTCTCTTAATAGCAAG
TATTCTGTCAACCCTGGCCAACTTGGAAGGTGAAGAGACTTTTGAAGCTGTGATGTTGGG
ACAAGCGGAGGAGGTGGTACAGGAGAGAATCTGTGATGACGAGCTGATCTTAATCAAAAA
GTAAGCTACTTTCCAAGCTAGGGAGCAGTGCAGCTTTTGTTGTAGAATTTCCTTCCCATC
TATTTGCTGCTGTAGTCTCTCCATGCTATGAGCAGTTATACGCGTGGGATAAAATAACAC
TGGGCCATTGTAACTAAATGGAGGTGACGTAACTGAGTCATCTCTGCTCCGTGGTCTAGA
CATGGCCGCGTGCACCCAGGATTTAATCGGTGGTGCGTGTGGAGTTGCTGTGCGGGTCTT
GTGGAAGTGCTGTTAAGAGTCTCACGTGCTCTCTCGCAGCACTAAGGCGCGTACGTCTGC
GTCCATCATCCTGCGCGGTGCCAACGACTTCATGTGTGACGAGATGGAGCGCTCCCTGCA
TGATGCTCTCTGTGTGGTGAAGAGAGTTCTGGAGTCAAAGTCTGTGGTTCCAGGTGGGGG
CGCTGTCGAGGCAGCGCTGTCCATATACCTTGAGAACTACGCCACCAGCATGGTAAGAGG
AGCTGCTTGCTTCCCACAGTGGGGTGGGCAGCTCTGGCATTTTCATAAATTTAAATAGCA
CGCCTCGCAGAGAGCTGAGCCGCTGCTGCGGGTTCTCCCTGTCCCCGTGTGAGGAGGAAC
TGTCTGTCTCTCAGGGCTCGCGGGAGCAGCTGGCTATTGCCGAGTTCGCACGGTCGCTCC
TCGTGATCCCTAACACGCTGGCCGTGAACGCTGCCCAGGACTCCACGGATCTGGTCGCAA
AGTTGAGAGCTTTTCACAATGAGGCGCAGGTGAACCCAGAACGGAAAAATCTAAAATGGT
AAGAACGGGAGTGCCCTTTCTCCCTGACTAGATTTTGTGTGGTAGTTTGGTTCCTAAGTT
TGTTATGGCTGACACCTCTTTAGCCATTCCAGGGCCTTGGGAAGACTCCTACCCTGGGTG
TTGTCACCTGACCTATGGTTCTACATTGGTTCTCAGGCAGCCTTGTTGGGCTTGTGCATT
ACCTAACAAGGATGAGAGATGTGTCGGGTGCTGTTACCATGACATCATAAGGTGCACTTA
GACAAACCGAGACGGCTGAGACACTGATCTTACATGTAGGCTGCTCCAGAACTTGGGCTG
TTTTTTCCCCCTTTTAACCACAGGATTGGCCTTGATCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCATTCTCCGCATTGATGACCTCATCAAGTTACATCCAGAAACTA
AAGATGACAAGCATGGAGGCTACGAAGATGCTGTTCATTCTGGAGCCCTTGATGACTGAT
GGGATTTCTCCTTTATTTATAACAATGTTAAATGCAATTGTCTTGTACCTCAGAAGTTAC
AATTAAAGTACAGTGAGTTGTCAGCTCGGATTCTTGTGAAGTAGGGAATGGTTTCCATCC
TCACTTTGGTCCTTAGTAGTTGGTTAGTGGACACCAGGCCCGGGCGAGTGTGAGCACGGC
TCACTGCTCACCCCCTCTGAACACACATCGCTATTCCCATCCCACCCCCGACACAAAGGG
CCGCGACGCCGCGCGCTCCTCCGGTCCTCTCCAGCGCGTGCACCAGGGTCACCAGAATGC
GGCAGCCGGACGCTCCGAGAGGGTGCCCCAGGGCTATGGCTCCTCCTTGGATGTTGATCT
GAGGGAAGGAAAGCTCTGTTAGGCTGCACACCCCAACACGTCTGTTCCCTCTCTGTCCTC
TGGCAGGGTGCCCTTTCCAACTGTCCTGGCTGCTAAGGAATAAATTTTTGTTACATCCAT
TCCCGACTTCCCTTGTCCCTTCATTGAGTTTTAACCTTGTTAGAAGGATTTCTTCTCCCT
TGGGAAGCAACAGTGAACTGAGTCCCAGCAGGAACTTCAGCATTTCCTCATGCGCGGGGA
GATAACCCTCGCACAGTGCGTGGACAGCCTGGCAGCCACACGGGCAGAGGCTGTGCTGTG
AGCTCAGGGGCACGGCCTAGGGACTGCGGCCCACAGAAGCCTGGCTTCAGTCCAGGTTCT
TAGCACCTGATCTTTACCTTCTCTGGGTTCAGTCCGAGTTCTTTAGCAACTGCCACTGAC
AGGGCTGCAAAGGCTTCGTTGATTTCGAATATGTCGACATCCTGCAGCGACCAGCCAGCT
TTGGCGACCTGAAGAGAAGGGCAGTGAGCGACAGGGCAGGAACGGGCGAGGGCTGCAGAG
AGGCGGCACGCTTATCCGGACGCAGACACCGCGGCTGTGGTGCTTAGAGAGGAGCCCAGT
GACGCAAAGTCAAGGGTGTCTTGTAGAGCATCACGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 1786..1896, 2234..2415, 2918..3044, 4501..4676, 4976..5099, 5379..5571, 5714..5877, 6322..6538
1001..1098, 1786..1896, 2234..2415, 2918..3044, 4501..4676, 4976..5099, 5379..5571, 5714..5877, 6322..6535
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved