Oryctolagus_cuniculus Locus CHD8
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus CHD8
Oryctolagus_cuniculus
CHD8
GeneScaffold_918
snoU6-53, snoU6-53
34376..34485, 39436..39544
43076
CGCCAAGGTCCCTGGGAACCAGGCTGCTGTTCAGCGCATTGTCCAGCCCAGCCGACCAG
TAAAGCAGCTGGTCCTCCAGCCAGTGAAGGGTTCAGCTCCTGCTGGAAACCCTGGGGCCA
CAGGGCCCCCTCTGAAGCCTGCAGTTACACTGACCTCTACACCTACCCAGGTGACTTGAT
TGAAAGGGGGAGGTGAATTTTGGATTTGTAGTGGGCCTAGCAGTTTTGTGAGAGTGAGTG
TGCATGAAAGCTCTCTCTGGGAAACCTTGTCTGTGCATTTTATCAGTTGGTGTTGACAGT
GACGTGCTTATTTCTTGCCAGATGAAAGCAGTTAATGTTAACATATTTTCTGCACTTACA
CTGCATGTTTCTACTGTGTCTACCTGGTGCTGAATCAGACAGACACAATCCCTGTGCTTA
GAGAGCTTAGTCTGTCAGGAACCATAGACATTAAGCAAAAATTTACAACAATGTATGATA
GAAAGTTTCATGAAATATAGGATCCTATGCCAACAAAGAAACATCTTTGGCAAATTATTT
ATTTATATTTGCAAGACTTGTAAAAGCATTATTTGTTTTCCTATGTATTTTACTAAGATC
ATCCCCTCTAACTTTGCTCAGTAAAAAGGCTAGTTCCGTCCTCTGAATAAAGGGCCAGAA
GAGTTGAGATAGGCAGACAATACTAAAATAAATAGAACCAGTGGGAAGAAGCCACAAGGA
GGCAGACTTCAATATAAGGTCTTTTGTTCTAAAAGATTTCCATTAATGTGAGATGACTGT
CTTAGAAGGTAGTGAGCCTCCCATCCATTAGGAGTTTTTAAAAAATAGCCTGGATATTTG
CTGGGCAGAGATGTTGTGGATAAGTAGATGAACACAATGTTACTATGTCTTCTGACCCTT
AATTTTTGTGACTCTAGGATGAAGAAAACTGGTATAAATATTTCAGGGTATACCATTCTT
TAATATTGTAACTCTCTTGCAATTTCCTTTTTTCACTTTAGGGTGAATCGAAACGCATCA
CCCTGGTCCTCCAGCAGCCACAGTCTGGAGGTCCCCAAGGACATCGGCATGTTGTGCTAG
GGAGCCTACCAGGCAAGATAGTATTACAGGGCAACCAGTTGGCAGCCCTAACTCAAGCCA
AGAATGCCCAGGGGCAGCCAGCCAAAGTAGTAACTATCCAGCTGCAGGTGCAACAGCCAC
AGCAAAAAATCCAGATTGTACCACAACCTCCATCTTCGCAACCACAGCCCCAACAGCCAC
CTGCAACCCAGCCACTGACTCTGTCCTCTGTGCAGCAGGCTCAGATCATGGGACCAGGAC
AAAGTCCAGGACAAAGACTTTCAGTGCCACTCAAGATGGTGCTGCAGCCACAGGTGAGAG
AATTACATAGTAAGGGAAAAAAGCAAACTTCTTAGACCCTTGCTGTTGCTTTCAATAGCC
ACTTACTGTTGCTTGTGGCATTATTCTAGATTTATACTTCTGAACTGAGATGGAGACTTT
TATTTCTTTCACCCATGGAAATCTTATTTTAATTATATCATGGAAAGATCAGAGACTCAC
TGAGTTTAGGATGAGATATGATTTTCGTATTTGAATGTTTCACATACAGTCTTTCCTGGT
ATCATTTTGAAGTGAAAACAATTAGAAATTACCCTTCTGTGAAGGTGAAATAAATAATCC
CTCTGCCCTCCAGGAAATAGAACTTGTATTTTTTTTTCTTTTTTGCCAGAGGCCAATAAT
GGCTATATTAATTACAATTTTTCTAAGATAATTGAAGTAGGTATTGCTAGGAGAGCTTGA
CAAAGGGATATTGAAATTTGATTTGACAGAATTTTTGTCTTTTCTCACCTCTTTCCTGCC
AAAAAAACACATTTTAAAAAATATGTCTAGATTCAGAGCCTGGTTCTTGAGAAACTAGAG
AACTGGTTTTAGCCTGTTTCAGAACTTGTTTTATTGAGGCCATTTAACTAGACACATTGA
AATTTTAGCATCTTTATTTCTATAGGCTGGCTCTTCCCAAGGGGCCTCTTCTGGGCTCTC
TGTAGTTAAAGTTCTAAGTGCCAGTGAAGTGGCAGCTCTGTCATCACCAGCAAACTCTGC
TCCTCACACGGGAAAGACAGGAATGGAGGAAAACCGAAGGTTGGAGCACCAGAAGAAGCA
AGAGAAAGCAAATCGGATTGTAGCAGAGGCCATCGCTAGGGCTCGTGCCCGGGGTGAGCA
GAACATACCTCGTGTCCTGAATGAGGACGAGTTGCCCAGTGTTCGACCTGAGGAGGAAGG
TGAGAAGAAACGTAGGAAGAAGAGCACTGGGGGAGAGGCTGAAGGAAGAAAAGCCAAAGA
AAAGCAAAACATCTGGAGCCTCCAAAACAAAGGGCAAGAGTAAACTCAAGTGAGTAGCCT
TGCTATTTGGCTGGGATATTTGTGGGTAATGCACTCATTTTTCAATAATGTGGAGAAGAA
CTTGTGTTGAGTCACTACACAGTTCAAGGTGTCCTATCATANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGCCAGAGAGAGAGAGAGAGATCTTCCATATGCTGGTTCACTCCGCA
AATGGTTGCAATGGCTGGAGCCGTTCCCATTCAAAGCTGAGAACCAAGAGCTTCTTCCGG
ATCTCCCACTCGGGTGCAGGGGCCAAGCACTTGGGCCATCTTCCACTGCTTTCCCAGGCC
ATAGCAGAGAGCTTGATCAGAAGTGGAGCGGCCGGGTCTCAAATTGGTGCCCTATGGGAT
GCTGGCACTGCAGGCAGCAGCCCCTCTCTTCTGTCTTAAATTTGAGAGTTGGAGAGATCC
CATCTACTGGTTCACTCCCCAGATACCTGTAACAGCTGAGGCTGACCTGTGCTAGAGCTA
GAAACAGAATTCTGTTCTCCCACGTGGATGGCAAGGATCAATCACTTGAGCTATCACTGC
CTCCCAGGGTATGCATTGATGAGAAGTAGAGCCAAGATGCAAAATCATATGCTAGATCTC
CCACATGGGTGACAGGGCCCAAATAGTTGGGCTACTTTCACTGCTTTTCCAGTTGCACCC
CAGGGAGCTGGATCAGAAGCAGAGCAGCCAAGATTCAAATCCACGCTTATATGAGACACC
AGCATTGCAGGCAGTGGCCTAACCTGCCTGTGCCGTGATGTTGGACCACAACCTTCTAGT
CTTAAACCAGCATTCTTTCTATTTTATGCTACCTTTCTTCAGGATTTGTGAACATACTGG
TGGCAGTGATTTGTCAGATCTAGTATAAAGATCATTCAGTGGTTTACAATACACATATTT
TCTTTTTTCGAACACCATATTTAATATCTTCAGCCTGGCCCAGCCTCCATGTGTTGTGGC
AATTTGAGGTGTAAACCAGCCAGTAGAAGATCTCTCCCCTGTCTGTCCTTTTGTCTGTCA
GTCTGCCTTTCAAGTAAATAAATAAATCTTTCTTAGGAAGAGTTCATGGGAAAATGGAAC
TGAATTTATTTATTTATTCATTTATTTGTTTGTTTATTTATTTAAAAGGTGGAGTTACAG
AGAGAGAGAGATCTTCCATCCCCTGGTATATTCCCCAAATGGCTGCAGCAGCCAGAGCTG
AGTCAGACAGAAGCTAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCAA
CGGTGGAATGGACCAGAGATTCAAATCAATTGAAGCTATACAACTGGCTTCCCAGGGGTT
ATGCATTGGATGGAGAAGTAGAGGCCAGGATGCAAAATTCATATGCTAGATCTTCCCACC
ATGGGTGACAGGGCCCAAAATAGTTGGGCTACCTTTCACTGCTTTTCCAGTTGCACCCCC
AGGGAGCTGGATCAGAAGCAGAGCAGCCAAGATCCAATCCCACGCTTATATGAGACACCA
GCATTGCAGGCAGTGGCCTAACCTGCCCTGTGCCGTGATGTTGGACCACAACCTTCTAGT
CTTAAACCAGCATTCTTTATATTTTATGCTACCTTTCTTCAGGATTTGTGAACATACTGG
TGGCAGTGATTTGTCAGATCTAGTATAAAGATCATTCAGTGGTTTACAATACACATATTT
TCTTTTTTCGAACACCATATTTAATATCTGAATGTATCATGGACTAAATATCCAAATGCT
TCTGTCTGGAAACTTGGTATATGATAGTTCAGATTAACTATATTTTTTGTTGTTTTTTCT
TTATTTTCACTTTATTTGAAAGGCAGAAAGACTGGAATACAGAGAAAAAAGAGAGGTCTT
CCATCCAGTGGTTGACTCCCCAAATGCCCACAAAGCCAGGGCTAGCCAGGCCAAAGTCAG
GAGGCAGGAACTCAATCCAGGTCTCTCATCTGGGTGGCAGGGACCCAAGTACTTGAGCCA
TCATCTGCCGCCTACGAGGGTGTGTGTTGGCAGGAATGCAGCTGAGACTCAAACCCAGGC
ACTCTGACAGGGGATGTGGGCATCCCGGGCAGTGTCTTAACTACTGTGCAAGAGCCCACC
CTATAATTATGTTGGGTTTTCACCCCTAACTTTTCCTTGCCCTCACTAAAAATGAGTTTG
ATTTTTCCTTCTTAGCACCATCACTCCTGTAGTGGGTAAGAAGAGAAAACGTAATACCTC
ATCTGATAATTCAGATGTGGAAGTCATGCCTGCACAATCACCCCGGGAAGATGAAGAAAG
CAGCATTCAGGTAAAAGTATCCCTACATAATTGAGTACTGGTTGGGCATCCTTAATCCAA
ACATTCAGACTCTGAAACTTTTCAGTGCTGACGTGATGCCACAGGTGGAAAATACCACAC
CTGATCTTGTGTGACAGGTTGCAGTTAAAATGCAGGTGCACTAAAAATATTGTATAAAAT
TACCTTTAGGCTAAATGCCAAAGATATATGTAGAACATGAATTTTGTGATTAGGCTTAGA
GTCCCATTCCCATGATACCTCATTATATATATATGCAAATATTCCAGAATCCAAAAAAGA
CTCCCAGATCTGAAACACTTGTCCTAAGCATTTAGGATAAAGGGAATTGAACCTGTAGAA
AAGTAATTTTTAATTATGTCAAACAAGCCAGAAATAGACTATAAATCCATGCATATTTCT
TCAGTTTTTCTAAACCAGATGTACACCTAGAAGGAAAGTGGGCATGGTCATTGTCTTTTA
AATTTTTGTCTTTTTAGGACAAAAAGCATATTATTTTACGAATAGGAATACTTGTTTTCC
CAAATTCCAGTGTTTTAAAAACTAAGCTAGTCATATGAAATGATTGTTCTTGTGATGATG
TCAGTATAGTACCTTTTTTTAAAGACTTATTTATTTATTTGAAAGGCAGGGTAACAGAGA
GAGAGTGAGAGGTCTTTCATCCACTGGTTCAGCTCCCCAGATGGCCTCAATGGCTGGAAC
TGAGCCTATGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAATCCGTAAAT
GAAGGTCTGAATTAAATGAACTCTAACTGTCTCTCTTAACTATATACTTATAAATGCCTC
TCTTTTTTAACATATATTCAGCACATTGACAAAATAATTACTTGGTTATTCTGGGGGGAA
TTAACATGAGAATTGCTGGAACATTTTTGAAAAGGAAAGATAAAATAAAAACCCAGGTTG
GGGCTGGCGCTGTGAAATAGCAGGTAAAGCCTCCACCTTCAGTGCCAGCATACCATATGG
GTGCCAGTTCAAGACCTGGCTGCTCCATTTCCAATCCAACTCCTTGCTAATGCACAGGGG
AAAGCAGTAGAAGATGGCCCAAGTGTTTGGGCCCCTGCACCATTGTGGGAGCCCCAGAAG
AAGCTCCTGACTCCTGGCTTTGAATCAGCCCAGCTCCGGCCGTTGTGGCCCTTTGGGGAG
TGAACCAGTGGATGGAAGACTTCTCTCTCTGTGTCTACCTCTGACTCTGTAACTGCCTTT
CAAATAAATAAACAAGTCTTTAAAAAAAAAAAAAAAAGAAAAAGAAAAACAACCAGGCAT
CAAAATATAAAGGGCATTTTAGAAAGGTCATGGAAAACTGGAATTAAAAGATGTTTATTT
TGGTGCAAAAAAATTGAATCCATGTATAGTTTTTTGTTTTTTAAGATTTATTTGTTTATT
TGAAAGGCAGAGTTACAGAGGCAGAGAGAGAGAGATTGATCGATCTTCGTCTGCTGGTTC
ATTCCCCAAATGACTGTAAGGGCCAGGGTGGGCTGATCCAAAGCCAGTACCCAGAAGCTT
CTTCTGCATCTCCCTCATGGGTGTGGGGGCCCAAGCATTTGGGCCATATTCCAGTACATT
CCCAGCCATTTGCAGGGAGCTAGATTGGAAGTAGAGCAGCCACGACAGGACACAAACCAA
CAACCAAATGGGGTGTCAGCACCACAGGGGAGGCTTAACCTACTATACCATGGCACCAAC
CCCTGGTTACAGTTTTATAATCATCAAGTAGAAGAGATACTTATAGGGAAGATATTAAAA
TTAGAGTCATAAAGGGAAAGTTTGATATCACTTGATATATAAAAATTGTGTATGGTATAA
CAACAAAGAATACCATAAGCAGGCAGTGATTAAGAGCATAGATTTTGGAGCCAAATTTCT
TGGATTCTTATCTTAACTCTTTCATTTATTAGCATTGTTGTCTTGAGCAAATTCCTTTAC
CTCTTGGTGCCTCAATTTCCTTACCTATAAAGTGCAGATAAGTTGTTATGAGAATTAGAT
GTAAATATTTATTAAATATATAGAACAGTTCTTACTTCATGGTAAGAACACACATCAGAG
AGTTGTATACATATTTGTTAAATTCAATAGCAAGGAGTTAACTATTTCTTAACAAATAAA
CAGGACATATTTTTATATACAAAGAAAACAAAGATTTAGTACAATTTAGAAAGTGGTATA
TTAGGGGCCAGCACTATGGTGTAGCAGGTGAAGCTGCCATCTGCAGTGCCGGCATCCCAT
ATGGGTGCTGGTTGGAGTCCCGGCTGCTCCACTTCCTATCCAGCCCTCTTCTATGGCCTG
GGAAAACAGTAGAAGATGGCCCAAGTCCGTGGGCCCCTGCACCCACATTGGGGACCCAGA
GGAAGCTCCTGGCTTTGGATTGGCACAGCTCCAGCCATGCCATCTGGGGAGTGAACCAGC
GGATGGAAGACCTCTCTCTCTCTGCCTCTGCCTCTCTGTGATTCTGTCTTTCAAATAAAT
AAATAAATAAATCTTTAATAAAGAAAGAAAGTGGTATATTAAATTACTAGGAGTACCAAA
ACAAAATACCACAAACCAGGTAATTCATACCACAGGTAACTTATTTTCTCACTGTTTTAG
AGGCTGCCAGTCTAAGATCAAAGGGTCTGTGGTTTTGGTTTCTCCTGAAGCCTCTCTCCT
TGACTTACAGATGGCTACCTCACATTATTTTTGTTAATACACATCTCTGATATCTTTCAG
TGTGTCCAAATTTTCTCTTATAAAGACTCCAGTCATTGGATTAGGGTCTGTTCTCGTGGT
CTCATTTTCACTGTACGAAAGGCTTTACATCCAATACAGCCACATTCTGAGATGTCAGGG
TTAGGGCTTCAACACATGAATTGGAAGGAGAGCGCAGTTCAGCCCATTACAGGGGGTAAT
ACTAATGCTGGCAATGTAAGGAACACTTTTCACATAGTTGTGGGAGTGGTAATTTGGACA
GTCTTTCTGGGGAGTCAGTGTTTTTATTATACAGTCATGCATTGCATAACGACATTTCCA
TGGACCACACCTACGACGGTGGTCCTGTTAGAGTATATCACCTAGTGATGTGGTAGCTGT
CTTAGATTCTGTAAGCATACGCCATGATGTTCCATAACAAAATCACCTCATGCCAAGTCT
CAGAATGTATGCCCAGAAACAAAATTGAAAATGTTAATACCCTTTGACTCCGTGACTCTA
CACCTGGGAAGTTACCTGTGACTATATTCTCAAAAATCTGCAGTGATACATCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTTATCAG
TTTCAGTAGTTCTTTGATCACATGCTATTGGAGCTTCCTAGAGATACAGTTGTGTTTGAA
AAATTATCTTGTTGGGACTGGTGCTGTGGCATAGTGGGTAAAGCCACCGCCTACGGCGCC
AGCATCCTATATGAGTGCCAGTTTGAGTCCTGGATGCTCCATTTCCAATCCAGCTCTCTG
CTTATGGCCTGGGGAAGCAGTAGAAGATGGCCCAAGTCCTTGGACCCTGCACCCGCATGG
GAGACCCCGAAAAAGCTCCTAGCTCCTGCCTTTAGATCAGCCCAACTTCGGCTGTTGCAG
CCATTTGGGGAGTGAACCAGTGGATGGAAGACTTCTCTCTTTCTCTCTCTCTCTCTCTCT
CTCTCTGCTTCTGCCTCTGCAACTCTGCCTTTCAAATAAATAAATAAATAAATCTTTAAA
AAAAGAAAAATGAAAAATAATTTTATCTTTCTTCCCCCAATTTTTTGTTGAGTCATATTA
CTTAAATTACTTAAATATTTTATTCAGCTACTTGAAAGTATAAGGCAGATGTATAAACTT
TACCATATGGAAAATATCCTCAAGAAATATTGTTAACTAAGTATATTAGCTTTTTGTTCC
TACAAAGAAAAACCTCAAACAAGTAAGTTTATAAAGAAAGCGTGTTTATTTTGGCTCAGA
ATTCTGCAGGTTCACAGTCCAAAACTAGGTGGCCCCATTGGTTGGGCACCTGGTGAGGGC
ATTGTTGCTGGCATGGTCATTAGGTTGCTCAAAACATCACATGGCAAGAGGGAGCATGTG
TGTGTATATGTGTTGTCTCTTAGGAACTAATCACCAGAACCCCACCTTCAGGCCAATTAT
AATTCAGTCATCTCCCAGAGACCTGTTCCCAGACAACTGTGATTGGATTAAGGTTTCCAC
CACACCTCCATAATGCCATTATCAAAGGACTTTGGAGATCAAACCTTTAACTCACAGGCC
TTTGGTGGCCATTCAAATTAATATGCAAACCATAGCACTAAAACAGTACATGGCAGAACA
ATACATATATAATTCTGTTTGTTAAAACAAAAGCAACTGTAAAACTGAAACAAAAATGCA
GAATCAAAAACAAATTATTTTTGTTCCTTTGCTCCTGATGTAAAATACACAGTACTCTAT
AGCTTTAGTGCACAGTTTTAGTTTCTCAGAACTTCTTACCAGGAGTATGCAAGTTTCTCA
GCGGATTCCTGGCCTTTGATAAAGCAATTCAGCAAAGTAGTACATGTGTAATAGTTATAT
ATAAAACATACTCATGAGAAAATGAGAGTGAAATGGAGAATAATTTCTTAATATTATTAA
AAATATTTTAGCCTTACATACTTCCTAGAAGGGTCTTGGGGAAAGCACAGGTCATAAATC
ACATGCCCTTCCTCCACCTTGCGGCGCCGGCACACCGGGTTCTAGTCCCGGTTGGGGCGC
CGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTATGGCCAGGGAGTGCA
GTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTG
GCTCCTGGCTCCTGCCAGGATCAGCGCGGTGCGCCGGCTGCAGCGGCGGCCATTGGAGGG
TGAACCAACGGCAAAGGAAGACCTTTCTCTCTGTTTCTCTCTCTCACTGTCCACTCTGCC
TGTCAAAAAAAAAAAATAAATAAAAAAATAAATCACATGCCTTGACAAAGCTCTTTATGT
TTTGGTGATTTTGCAAGTAAATTTTTGGGTAAAATCTAAGTATATGATTATAGGCAAATA
ATTTTAATTTTTTCCTCTTTGAGAAACTTAGTTATTTTAACTTTTTTTTTCTCTACAGAA
GAGACGCTCCAATCGCCAAGTTAAGCGAAAAAAATACACTGAGGACCTAGATATAAAAAT
CACAGATGATGAAGAAGAAGAAGAGGTAGATGTAACTGGTCCAATAAAACCTGAGCCTAT
CCTCCCTGAACCTGTGCAAGAACCAGATGGGGAGACTTTGCCTTCCATGCAGTTCTTTGT
GGTAAGCTGAGAGCTTAAGAAATCTATGAGATTTCTCTTGCTCTTCACAATGATTTGTAG
ACTAACCACCTCTTTTGCTGCAGGAGAATCCCAGTGAAGAAGATGCAGCCATTGTAGACA
AAGTGCTTTCTATGCGGGTTGTGAAGAAAGAGGTAAGGCCTTGATATGTTTATTATCAAC
CCATAATGTTCCATTCACAGGCTTTATCTATTGAGTACCTTTCAGTGTCAGGATATATTG
CTAGGGTATAATTGAGAGAGATGATGGTGGATAGTTAGCTCCAAATCAGGAACTATCTTA
TACCTCTTTTTTACTTATCTGTCAGGAATGAGTACGGGCATATTTCTAATTATTACACAT
CTAGTATTGAAGTACCAGATTAGTTCCTTGGTGGCTGAATCAATAATATATTAAGGAAGC
ATCAATATGAAGTTCTGCCATTTATGGTTACAATTAGAAGTTCTTAAACAGGTAATGGAT
TATTGACTATAATTCCTTTCTTTCTTCATAGCTTCCTTCTGGACAATACACTGAAGCTGA
AGAATTCTTTGTCAAGTACAAGAACTAGTATGTGACCTGTGCAAAAAGCTTTTCACCCTA
AACTCCACAGGGTTGTAAAAATTCCTCCTGTGTAGAATATCTTGGGTGGGAATGTGGCCC
TTTTTTATAGTCTCCTAGCCCAAATTGCCATTTTTAATGGGAAAATGTGTCTTCAGAGAA
AATTTCAGGTACTGCTGTGACTGTCACTATTTTCTTGCAGGAAGGTAGGATAAGGGTGGT
TCCCAATAAAAACTGACTGTTTGTAATCATCTCTTAGTCTGCCATTAAGATTTATTATTC
AAAATGTGATTTATGGACCAGCAGAATTAGCATTATTTGGGTACTGTTTAGAAATGTGGA
CTTTTCAAGCATACCCATACCAGGTGGTTTGTGAGCAAATTGAAGTTTCAGAAGCACTAA
CCTAAGATATGTCTCAGTTCAAGCACACACTTGTGTGTCTGCTTCTGGCTAATCTCCAAA
TTAGCTTGCCAATCTGCCTTTCTTGCACCATAACTGGCTATTTCCATTCCCTTCAGCTCC
TATCTGCACTGTGAATGGGCCACGATCTCCCAGCTAGAGAAAGATAAGAGGATTCATCAG
AAACTAAAACGCTTCAAAACCAAAATGGCACAGATGAGACACTTCTTCCATGAGGTAATT
AACAAGTATTGAGTGTCATTTCTTTCATAATGCACAAATTACTAGGGTTGTCAGCCTTAG
TTAATTATGTAACAGTTGGTTTGTATATTTAAAAGTTTTAATTTTGGTCATTGACTTTCC
TTACTTTGTTGCCCCTTGCTCTGTTTTTTGGTTAGAGAGCATAGTATTTTGAGATTGACT
TCCTCAGTGTGCATGAAATATTTTCAAAACAGAAAAGTGATCTTTGGTCCACTTAATGCA
TTCTTTAGTCTCTAATGTCATTCTTTCCTATTAATGGTATCTGTAGACATAAGTAGCATC
TTTAAGAGGGAACATTTATTTTCTCAGCTTTCTAATGCAGTATTAATAGAAATAGTGATG
AAGGAACTGTAATTTCCCATATCCAGGGTTACTACTAGTTAAACGCACAGCATACATGAG
TAAAGAGATAATCCATTGTATTTGACAATTTGGAGGTTATTCATGACCTTGACAAAAGTT
ATTTTAATTGTGTGATGTAAGTGGAAGGAAGGGTGGAATGGATGGATAGATGAAGGAGAT
GAAGAAGTGAACATAATGTGTATTTAAAACTTTGGGAGAAATTTGCATATGAAGGAAAGC
AGAAAAATAGTTTCAGAAGGATGTAGAGTTAAGGGAAATCTTTTTAAAGACGTGAAATAA
TGGATCATATTTATTTATGGGAACAATTTAGTGAAGAGGTATTTTTAAGTAAAGAAGAGG
GGTAGAATTCGGTACAGGCATTATGGTGCAGTGGGTTGAGTCACCACTTGGGATATCTGC
ATCCCATATTGGAGTGCTGGTTAGAGTTCCAGCACGTCTGCTTCTGATCCAGCTTCTTGT
CTGTGCATCCTGGGAGGAAGCAGATGATGGCTGAAGTGCTTGGGCCCCTGCCACCCATGT
GGGAAACCCCATTGGAGTTCCAAGCTCCTGTCTTCTGGCTATCCTAGTCTTGGCTGTTAG
CATTTGGAGAGTGAACCAGCAGATGGAAGATATTTCTCTTTCTGTCTGTCTCTGTCTCTG
TCTGTCTCTCTCTCTCTCTGACTTTCTCTTTCTTGCTCTGCCTTTCAAGTAGATGAAAAT
AAATAAACATTTAAAAATCTAGAACACAGCACTTTTTAAAAAACAGGATAGAATTCAGAG
CATACATGACCTTTGTGAGGGAGAAGAGATACTTTCTCTGATAACAGATGAGAAGATAGG
TAAAGACCCAGATAAGTATATAGGATTTGATATTGTGAAAATGGGAGACTCCCATCAAGT
GGCTTTTGTTCTCTTTAAAGAAAAATTAAAAACAAGAACATCTGCTAAAGCTGAAGTGTG
TAAGGGATTGGGTTGCCAGATAGTGATTTTCTTTCTTGGTCTTATTTTTGTTTCATGACA
TCTAGGATGAAGAGCCCTTTAATCCAGACTACGTAGAGGTGGATAGGATATTAGATGAGT
CTCACAGTATTGACAAGGACAATGGAGAGGTAAGTTGGGGTGTGGAGAAAAATGAAAGGT
TCCTTATAGATTTCTACTGGCCCGCTTGCCAATCCTTTATTTTTCAGGTATGGCTGAAAA
ATCCCTTGGACTGACTGAAAAGATATTTCTGAATTTTTCTGTGGGATCCTTAGAAAGATA
ATGGGAAGGTAAGAGAGTAGGGAGAGAGGCTAAAAGGAAAAATTCCTATTAAGTGAAACA
TTCAGGAGCTTGAAGTACTGAAAATCGTTTACTTTGGTCTCATTTTTCCTCAGATTTTAT
TGTGGGTGAACTCGTAGTAAAGTAGGAGATGAAATTGATGGGTAAAAAGGATATCATGTA
AATTTTTAAATATATGGATATAAAAATACTTGTACAGGCTCCTACTTTTCTCCACATCAT
GTTGCTGAGAATTGGGAATTTTCTGAGCTCACTATTAGTTAAATGCCCTTTTATTTGTTA
GTAAACCATCTGCTGCATTTGAATCTGTATTTTAAAACATTTTGGAATGCCATTCCCACA
AGTTCAGATTCAGTAAGTCTGAGGTGGGACCCCAAGATCTTTAAGTTCGTCTCTTAGGGT
TTTCATGTGTAACTTGATTTGGAAATTGCTGTGTTAAAGCTTTTGTAGCTTGGGAAATGG
ACTTTACATATGCTAAAGCACTTTCTGATGCAGTTTCACAAATTGCCTTTTTCAGTTTTC
AGATAGAGTCAGATAAGATCTAAATCACCAAAGAATTCAATATTCTGTCTTTTAAATTTA
CTTAAAACTTCTGTTTAGGCTATGAACTAACATTTCTTCCTTTTTTGTAAGATAATCTTT
TTTTTTTTTAAAGATTTTATTTGTTTGTTTATTTATTTGAAAGGCAGAGTTACAGAGAGG
CAAAGGCTGTGTTGATCCAGAGCCAGGAGCTTCTTCCAGGTCTCCCACACGGGTTCAGGG
GCCCAAGGACTTGGGCATCTTCTACTGCTTTCCCAGGCTGTAGCAGAGAGCTGGATCAGA
AATGGAATAGCCAGGACTCGAACTGGCACCCATATGGGACACCCACACTGCAGGCAGGGG
CTTTACCCACTACACCGCGGCACCAGCCCCCACCAACATTTCTTAAGAACTCTACTTTCT
TTTCACTTCAGGTAGTAGTTGCTGGCTTGGCTTTGCAAGGTCATATTTCATTAAAAAAAT
TTATTTATCACTTATGATGACTGCTTCTTACACAGTGACCAGAAGAGAACAACAGAACCT
TGTTAAGATGCCAGTGCTGGGTGGTGAGCTGGGCTTACTTATAATCTGAGTTACTTACTC
CTGTCTCCTGTACATCATTCTTTTTTTTTTTTTTAAAGATGTATTATTTATTTGAAAGGC
AGTTACAGAGAGTCAGAGGCAGAGAGAGAGAGAGAGATCTTCTTTCCACATTCCCCAGAT
GGCCACAATAGCTAGAGCTGAGCTAATCCAAAGCCAGGAGTCAGGAACCTCTTCTGGGCC
CCCACGTGGGTTCAGGGGCCCAAGGACTTGGGCCATCTTCCACTACCTTCCCAAGCCGTA
GCAGAGAGCCGGATTGGAAGTAGAGTAGCCAGGACTTGAACCGGTGCCCACATGGGATGC
TGACACCATAGGCATCAGCTATGTCTGCTATACCACAGTGCCGGCCCCCTGTACATCATT
CTTTTAGGACCTGCAAGTCAAATTTATCCCTCTATAAGATACCCAAGTTGACTCTACTTT
ATAAGCTTTCAGGATCACTCAGAGCCTTAGATGTCCGTGGCCTATTCCAATTCACCATCT
ATAAATCCCATCATGTATGCTTCAGATAACATATATTCTGCTTTGGGGTTGGGGATGGGA
GTTACTATGTGTTCACTGTGTGTTCATTTGTGGGAGATAAATGGAGAATAACCCATGCAG
TTATTAGGACACTCTTAAATTCTCAACTTTTTTTTAAGGATCTCAGCCTTCCAGCCTTGA
ACATCTTAATGCTCTCTACCTCCATACTTACTCTTCTAAAAATGACTGACCTTTTTGGTT
AGGCCCCTTTGAAATGTGTTGTAGCTGTCATGACATATGAAAGAATTTTGATAGCCTGAT
ACTATAATTTATGTTGCCAGTATTGGATAATAACATTCTATTTACCTGTTCCCCCCCCAC
CACCACCAAATTGGGTTTAATTTGTCATCCAGTTTACACTATCTAATAGTGAAAATAAAT
ATTACCATCCTTAGAAAAATAAGGTACAGTACTGGAAATATAAGACCTAGAGTATGACCT
GAGTCATTACATGTTAGAAAGATTAAAAACCAGCCAGATTAACTAGGGATTCCCTGATCT
GTTAGTGTGTTAAGCACTTTCACATTTATGCTTGCTGTTTTGGGGAGTGTTCTATGAACT
GATAATTAAGGATTCTTGTTGATTACACTAAGTCTTTCTTGCTTACGTAAGGCAAAAATG
AAAATGCATTAAGTGCAGTGATTATGAATAGTGAAAGTAGGAGCTTCGTTACCATTGGTC
ACTGATCTTTGTAGAGGAATGTCAACATAGAAGGGTACTATGGTCAGAGCTTCAGCGTTT
CTTCCTCTTAACTCATATGAGTTACCTCTGTTCAATGAAACCTGTTATCATTGCTCTCTG
CCCTTTGAGGATAGTATGTGGGAGCTAAAAGAGGATGTTGATGAGGGCAAGATTAGAGAA
TTTAAGTGGATCCTGTTATGTTATCTCCTAGCTTCCTGGAGCTCCCAGAGAAAACTCTTT
ACCACCAGATGAGTACTCTGGAATGCACAGAACTGTAGGGGCTCAGAAGTCCAGTGATGT
CAGCACATGATGTGCTCCTGCGGGTTTACGCTGTTCTTCATCCTAAAAGTAGCCTGGTTT
CCTCTGTATCAAACTCCGTGCCAGGAGGAAAATATGGGATTGAACCATATCTTTTAAGAA
AAAAAAAAAGACTATTCTTGCATTTGTTGGTTGATGAGTATAATGCTTTAGGGCTTAGTG
TTCTAGAAACAATTGGGTAGAAATTTTACTTCTAGAATAGATTCAGGTGAATTACTTAGA
GGAACGATCAAAGACACACATAGTGCATCAGTAGGTGACCCTGTTGTTGGTATGTTCAAC
CTGACTTTTTCAGCAACTTTTGTATACCAACACTTTGTGATTTGACTTTATAGTCAAATT
CCTACCCTGTAACCACAGCTGAGTACAGAGTCTGTTTACTAAGGCATTGGCTTTTTCTCT
CCTAGCCTGTAATTTACTACTTGGTGAAATGGTGCTCTCTGCCCTATGAGGATAGTACAT
GGGAGCTAAAAGAGGATGTTGATGAGGGCAAGATTAGAGAATTTAAGCGGATCCAGTCAA
GGCACCCAGAACTCAAAAGAATGGTAAGTACATTTATGTTTTGAAATGTACAGAGCAGGG
GTAGGGAGTATCCAGCCTGAGAACCATAGAAGGCCTTCAAAATCATTTGATCTGGCCCTG
CCATGGCAACTGCAAGTGGGACTAAAATTCAACAAACCTATAGCAGGTTAATTTTTAAGT
TAGTAATTCTGTATGGCCTGCAAATGACATTATAAATATCCAAGCTGCCCTTGGCCAAAA
AAAAGGTTCCCCACCTCTGATTTAGAGCATAAAGTTTTATATAGGTAATGATTTAATTTT
CCCCTGTAGAGTTTTTGTTGGTTTAGTTTTATATTATGGAAATTTTTAAACAAACAAAAG
TTGAAGACATAGTATTATGTAACTATCATGAAGCTAACAATGTGGCCAATCCTGTGTCAT
GTATTTCCTCACACATTTTTTTCTCATTTCCTACATCATTTTAAATCAGATCTCATATTC
CTTAATTTTATGTGTAAATATTTCAGTATTTATGCCTGAAAGATAAATAATAGCATTATT
ACACTTGAAAACATTCAGACATTCCTTATCAAGTAGCATTTTGTACCTTTTCCTGAATGT
CTTAATTTTCATTTAATTGTTTGAATTGGAATCTAAATAAGGTGTTTTTATTGTTATCAC
TAATATGTTTCAAAATTCTCATTTATATAAAGGGTCTTCAAATAGTTTATGGAAAAAGCA
CATTATGAAAACACTGCATAGATTTCACAATTTTTTGTGCCAAAATAGACTTAATATATT
TTAGTTCATTTTCCACCAACTTTGTGAAATATTTTTATGGTTCCCTCTTAATTTCTCCTT
TCCTTCCTTTACTGTATTCTCATGAAGAAACCAGATGATTTGTTCTGTAGAGCCTTCTAT
AGTCTGAAGATTGCTGATTGTATTTCCCTTGGTGCCTTGTAAAATATTCTGTGTCCCTGA
TAATTTCATGAATGGATAAGTTTAGAGCTATGCCATCCAGTATAGTTGCTATTAGCCACA
TTTTTTTTAATGTTGAGAAATACTGTTAGACATCACTGTTCTTGGTAAGATAAGGGATAG
AGACCAGTCAAGTGCTTCATAGACAGTGGTGTATATTTCCATCAGGTTGTGTTTTGTCAT
ATTATCAGCCATTTTTGATCATTGCCCAGATCCATTCTTTAAAGATTTTAAAGTAATAAT
ATTTTAATTCTGTCATTTCCTCATTTATTGGCCAGAACATTGTTTTCTCTTTCTTTCTTA
AAAACAGATTTATTTTATTTATTTGAAAGGCAGAGTTGTAGAAAGGGTGAGGGAGAGTGA
GAAAGAAAGAGAGCTTTTTGTCCGTTGATTCACTCCCCAAATGACTTCAATAGCCAGGGC
TGGGCTAGGCTGCCAGGAGCCTAGAACTCCATCCAGGTCTTCCATGTGGATGGCAGGGAC
CCAAATACTTGGGCCATCATCTGCTGCTTTCCCAGGCACATTAGCAGGGAGCTGTATTGG
AAGTAGAGCAACTGGGAGTCAAACCAGTACTCATATGGGGTGCTGGCATTGCAGGCAGTA
GCTTAACCCACTGCCCCACAATGCCATCCCCCAGAATATTATATAAAATAAGTTTATTTC
ATCTGCTACTTGGTCTTTCCTTGAAGTAGAGATTGTTTAGAAAGGATACATACTTTATTA
TTCCAAAAAAAAATGAAGTTTCCTAGCATCTTACAAAGGTGGGTTTTTCTTCTTTTCTTT
CATCTTTTTTTAAAAAAAATCATCTCATAAATTTAAATATTTTAATCCAAGCAGTAAAAT
TTTTTAATTGACTTGAACTACTAGAACTACCTTGTAAGTCTTGCCTGATTCTGCTAGTGT
CTCCATCCCATTTATTCAAGTTTCCTGTTTTTTAGAATCGCCCTCAGGCGAGTGCCTGGA
AGAAGTTGGAGCTATCACATGAATATAAAAACAGAAACCAGTTACGGGAATATCAGTTGG
AAGGGGTCAATTGGCTGCTTTTTAACTGGTATAACAGGTAAAAGAGTGGACTCATTAGAT
GAAAGCTTAGTCTGGGCATTATTTTTACTCATTTTCTATTGAAATAATTTCTTTGTATGT
TCTTTTTTAGAGATGATATCTTTTAACATAGTTTTTTCTCCCTCCCCATGATAAATCTGT
AGGCAGAACTGCATCCTGGCTGATGAAATGGGACTGGGCAAAACTATTCAGTCCATTGCC
TTCTTGCAGGAGGTATATAATGTGGGCATCCATGGCCCCTTCTTAGTCATTGCCCCTCTG
TCAACAATCACTAACTGGGAGCGAGAATTTAATACGTGGACAGAGATGAACACTATTGTG
TACCATGGCAGTCTGGCCAGCCGGCAGATGATTCAGCAGTATGAAATGTACTGCAAAGAT
TCACGGGTGAGTTGCATGTCCTAGGAATGCTGTGGTGTAGGGAAAGTAGGCCAAGGAAAC
TGGCATTTTAGGGACAATATATGAATAAAAGACTTTAATTTAGGCTTTTTTATGATTTCA
GGTATTTTTTTTACAGCAGTACGCAGGCCATTTTTATTTTTCACTCTATTTTTACCCAGT
AAACATTTTGATCCAGTGGAAGTTCTGACTTTACTTATGAATATACACATTTTTAAATAG
AATTTTACCAATATTGATGAGTTTTAAAGTATTTCCCAGACTAAAATTCTAGCTACTTTT
AGTACGTTGTTCTGTTTCAAAGATTTATTTATTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCATGCCACAGCAGCCAGGGCTCAGTCAGACCACAGCCACGTGAGCCC
AGAGCTCGGTCTGAATCTCCTCTGTGGGTGATAGGGACACAGCCACTTGCCCTCACCTGC
CACCTTTCTCCTAGGTTGTGCATTATCAGGAAGCTGGAAATCAAAGCAGAGCAAGCACTC
AAATGCAAACACTCTGCTAAGGGATACAGGTGTCCCAGGCAGCTTTTTTTTGTTTTATGA
ATTATTTTATTTATTTGAAGTGTAGACTAACAGGGGGAGAGACAGAGAGAAAGAAATCTA
CCATCTATTGGTTCACTCCCTTAATGGTCAGACTGAAGCCAGGAACCAGTTACTCCATCT
GGGTCTCCCATGTGGGTAACAGGGACCCAATTAACTGGGCCATGTTCTGCTACCTTCGCA
GGCACATTAATAGGGAACTAGATTGGAAACATGGCACCCAGGACTTGAGCTAGCCCTCTG
ATATGGGATCCAACATTGTAGGCAGCGTCATAACCTGCTGTGCTACATCATGGATTTCCC
AAGCAGCATCTAACAGTTAGGCTAAATGCCTGCCCCTCTTAATTTTGTCAAATGATTTTA
TTCTAATATAAATTAGACAATAATCAATATTAACATATTTCTGTATTAGCTGTTTTCACT
CTGAGTTTTGTCTTATATATTTCAGCATTGCCCAAATTTGTGGAATTCATTATTAACCAA
CAAAAGATCAGGGCAGAGATACATGAGCTAGGCACACAACAGTCAAAAATGTCCAGCTTT
GTTCAGTGAGCTCTGTTATTTTCCCAAGAAGCTGAGTTTGTTGAAGAAGCAATGTATCTT
ACATTCAGTGATTTGTCCCTGTTTATCAGGAAGATAAGCAGTAATGGAGTTGGGTGGTGC
TCTCAGTTTGTATTTCTTAATAAATGTGCCTCAGTATAGAAGAGTAATTCAGAAGACCAC
CTCACTCATTTAGTTACATTTTAGGCCTTTTCTGACTTTACCGCCTTCATGCTTAGGGGC
GTCTCATCCCGGGTGCATACAAATTTGATGCCCTGATCACCACTTTTGAGATGATCTTGT
CAGACTGTCCTGAGCTCCGTGAGATTGAATGGCGTTGTGTCATCATTGATGAGGCCCATC
GACTGAAGAACCGTAATTGCAAGCTGCTTGATAGTCTCAAGCACATGGACCTGGGTAGGT
TCTCACTGACTTTTAAACGAAAACTCGGAATTAACCGTAATTCCCTGTGGAAATTACCCT
AATTTAGCAGAGAAGAAAAAAGAATCACAATCTTGGTTTTGAGTGGGTAGGTATGGCCTA
TTGGAATGCTGGCCTGAAAATCCAGCATATATTAGTTATCTAGTCCTGGTAGCGAAGTAC
TCCAAAACTTACCAGCTTAAAACAACAAGTGTATTTTTCATGATTCTCTAGTTTAGCCAC
TTATGTTGGGCTGAGTTAAGCTGTTCTGACTGACTTTTCTGAAGTCATTAATGCTCAAAC
TGGCAATTGATACTACTTGTTGACTGGAGCACCTGAATTATCTCCTGTTAGGCCAGACTA
AGCTTCTTTACACGGAAATCTCAGGGCAGTGTTCCAAGGGGACAAAAATGGGAGCTGCAA
GGCCTTGGAGGTAGGCCCTAAAACACACAGTATACCTCTGCTGTATTTCCTTTGTCAGAA
CAAGTTATAAGGCAAACCTAGATTGAAGGGGTGAACCTCAGTAGGAGATTAATAGCCATA
TTTAATCCAGCACAGGGGCATTTCCTAGAGAGGCAAAGATTAAGACATCTTGGGGGGGGG
GGGGGGGAGTTGATTGTGAATAGGCATATGCAATTGGTAAACACATAGTGTGAATTACCA
TTTACTTATAATATTTGTTATTATTTTTCCCCTGTTAAATAATTCCCAAGGGTTTCTTCC
GTGCCTTGTGTTTATCCGAGGAGGAAGCCAACAGAAGAAAATAGTCTGGGCTATTTCCCT
CATTTTATAGATAAACTAGAGCTAAAGATTTTATACTTGATGGAAAAGCCTAGAATTTCC
CCTGTGTTTTTTAATGTTACCATTCTGTTTTCTCTATTTCTAGGGACACAAAGTGTTACT
CACAGGAACACCACTGCAGAATACTGTGGAAGAACTGTTTAGTTTACTTCATTTCTTGGA
ACCTTCACAGTTTCCTTCAGAATCAGAATTCCTCAAGGACTTTGGGGATCTCAAGACAGA
AGAACAGGTAGGAAATCTGTCTAATGAGGTACTAATGCAGGACAAAAAGATGGAGTTTGT
ATAAGGCAGACATCTGTGGCTATAAGCATCAAGGACTGTTCTGAAGTCCTTTGAATCCCT
TGCTGATCATCTGCGGTATTGTCCAAAATCTATATTCCTCAGATTCTAGAAAGCTCTAAT
TTTATTAATTCAGCATTTCTACATAATATGAGAATATTTATTGTTTCTGTGTTTCTACAT
AATGTGATTTCTTTTTCTCTGTGTAATAAACCATAGGTTCAAAAGCTACAGGCCATTCTC
AAGCCAATGATGCTGAGAAGGCTTAAAGAAGATGTTGAAAAAAACTTGGCACCCAAACAG
GAAACTATTATTGAAGTAGAGCTGACTAATATCCAGAAGAAATACTATAGGGCTATTTTG
GAGAAGAATTTCTCCTTCTTGTCCAAAGGAGCAGGTCACACCAACATGCCAAATCTTCTC
AACACAATGATGGAGTTGCGAAAGTGCTGCAACCACCCGTATCTCATCAATGGTGAGGAA
ATTCCTGGAAAATATGTGAACTTCTATGTTTCCTGTGTTTATATTCTGAATGATATTCCT
CAGGGAAAATGGATGCACTGACTGATGCAATCCAATTTGGGGATAGGGACAGGGAGTTAG
AAATAGGTCTCCTTTTCAAAAAAGGTTCTTAGGTGGAATGTCTTTCTCTTATTCTATCCT
TTTGATCCTACATAATCTTCAAAATTAAATAGGATTTGCTGCTTAGAATTTCATGAAGGA
GAACTTAGGTTTTCTGTTCTTGGAATATTTTGTATAACAAAACTGAAGATGATTTAGAAA
CTTTGGTGCTTAAATTCTATGTGTGAGAAAGTTTTATCTCCAGTCAGATAACTTTTTTCC
TTTGTACTCTTAAATAAGCCACCAAAATAGATAAGCCTTAGTATGTTCCACTGAATGTCA
ATATAAAATTTTGATTTTTCTCTTGGCAGGTGCAGAAGAAAAAATCCTAACTGAATTTCG
GGAAGCTTGCCATATTATACCTCATGACTTCCATCTGCAGGCCATGGTTCGTTCAGCTGG
CAAGTTGGTTCTTATTGACAAGCTACTTCCAAAACTTAAAGCTGGTGGCCATAAAGTGCT
GATCTTCTCCCAGATGGTACGCTGCTTAGATATCTTAGAGGATTATCTAATCCAGAGAAG
GTGAGAAAAGAGTCATTCTAGTCTTATGATTACTGTATGCTCATAAAGCTATGAGGAGTT
GGAGGGCCTGGGTTTAGAGTTAGCCAGTTGTAATAAAAGAAGTATGTAATACATTTAGTT
TCAATTCCGCTACATGGTTTTTGGCCAGCTAAGGATATTGATCCGAGCCTGCTTTCTTGA
TTTGTTCCTCTGCTTAGCCACTTACAAGGTTTTTATGTGACCTCCTATACAGGTACTTAT
ATGAACGTATTGATGGGAGGGTTAGAGGCAACCTCCGACAGGCTGCTATTGACCGCTTCA
GCAAGCCTGACTCAGACCGCTTTGTCTTCTTGTTGTGCACCCGTGCTGGTGGACTTGGTA
TTAATCTTACTGCTGCTGATACATGCATCATTTTTGATTCAGACTGGAATCCACAAAATG
ACCTCCAGGTAAAGGAAATTATTGTCTTTGGGACTAACTACCTAACTTGGGAAGTTTTCA
ACAAGACCTGGATCTCTTAGACCTCTCCTACAGAGAGTACAGAATTATTTTCTTAGTTAG
GGGTTGCAGTTAATTCAGGGGTCAGCAAACTTTATGAATAGCCAGCTAATAAGTGATGTA
TCTTTGTGGGCTATATGGACTCTAGCAACCACTTGATTCTACCTCTATAGCAGAAAAGCA
GCCATAGACAGTATTTAATGAATAGGTAAGACTGTTCTAGTAGACTTTTATTTATGGAAA
CAGATCTCCATGCAGACTGTATAATTTGCTGACCCCTCATGTACAAGATGGAATAAAAAT
TTTATCTTGAAATTGACTTTGGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCCGTCTTG
CGGCGCCGGCACACCGGGTTCTAGTCCTGGTCGGGGCGCCGGATTCTGTCCCGGTTGCCC
CTCTTCCAGGCCAGCTCTCTGCTGTGGCCCGGGAGTGCAGTGGAGGATGGCCCAGGTGCT
TGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGCCATCGGATCAGCG
CGGTGCGCCGGCCGTGGCGGCCATTGGAGGGTGAACCAATGGCAAAAAAAAAGGAAGACC
TTTCTCTCTTCTCTCTGTCTCTCTCTCTCACTGTCCACCCTGCCTGTCAAAAAAAAAAAA
AAAAGAAAAAAGAAATTGACTTTGGTTTTAAGTTGATCACATAGCTGTTTTATAAATGTA
AAATCATTTTGAATTGGTATTTTGTATTTTTTAACCCTCTAATTTTATCCTGTCTTTCAC
TGTTTGTTTGTTGTTTTTTTTTTTTTAAACCAGGCCCAAGCACGATGTCATAGAATTGGA
CAGAGCAAAGCTGTAAAAGTATACCGTCTCATCACTCGTAATTCCTATGAGAGAGAGATG
TTTGATAAGGCTAGCCTCAAGTTGGGATTGGATAAGGCTGTACTTCAATCCATGAGTGGT
CGGGATGGCAACATTACTGGAGTGAGTTTTCTTAGTCCATAGATAAGTTTATAATGAGTC
TTAGTGATAGAGATAATAGATATTTTTTTCTTTACAGGAATCTGAGTACCTTGTTCAGAT
TCTGAATTCTTTTTTAAGTTTGTTATTTACAAATAATTTTATCAATTATTTCTTATAATG
TAATGGCCCAAAGATGAAGGCATGGGGCCTGTTTTGTGGTACAGCGGATAAAAGCCACTG
CCTGCTATGCCAGCATCCCATATGGATGCCTGTTTGTGTCCCTGCTGCTCCACTTCTGAT
CCAACTCTCTGCTATGCCCTGGGAAAAACAGCAGAAGATGGACCAGGTGTTTGGACCCCT
GCCACCCATGTGGGAAACCAGGATGAATTTCTGCCAGGCCCAGCAGCCATCTGGGGGTGA
ACCAGCTGGAAGATATCTTTCTGTCTCTCTGGCTATCTCTGTCTTTCTGTAACTCTGACT
TTCAAATAAATAACTTTTTTTAAAAAAGATAATACTATCATGTACTTTTTTCATCTTTCT
GTTGGGTTTTGTAGATCCAACAATTCTCCAAGAAGGAAATTGAAGATCTCTTAAGAAAAG
GAGCATATGCAGCAATAATGGAAGAAGATGATGAGGGCTCCAAGTTTTGTGAAGAAGACA
TTGACCAAATCTTGTTAAGACGAACTACAACTATCACCATTGAATCTGAAGGAAAAGGTT
CTACCTTTGCCAAGGTATGATCTGTCTGTGCCAGAGAATGGTAAAGCAGGGATAGAAAAA
GGAATCTGTAAGATTAAAATATATTTTACAGATATAATTATCGGGGAAAATGTTTGGTGC
AGTGGTTAATTTATTTTTTTTAAATATTTATTTATTGCCGGCGCCGCGGCTCACTAGGCT
AATCCTCCGCCTAGTGGCGCCAGCACACCGGGTTCTAGTCCCGGTTGGGGCGCCGGATTC
TGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCAGTGGCCAGGGAGTGCAGTGGAGG
ATGGCCCAGGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGCTCCTG
GCTCCTGCCATCGGATCAGTGCGGTGCGCCGGCCGCGGCGGCCATTGGAGGGTGAACCAA
CGGCAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAA
AATTTAAAAAAATAAAAATAAAAAAAAAATAAATAAAATATTTATTTATTTATTTGACAG
AGAGAGGCGAGGCTGGGGGGAGGGGGAGTTCTTCCATCCATTAGTCCATTCCCTAGTAAG
CCGCAGCAACCAGAGCTGCTCCAATCTGAAGCCAGGAGCCAGAGTTTCCTCTGGGTCTCC
CACATTGGTGCAGGGACTCAAGGACTTGGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTCCCAGGCCATAGCAGAGAGCTGGATCAGAAGTGAGCAGCAGTCTG
ATCAGCTCCCATATGGGATGCCAGCACTGAAGACAGTGCTTTACCTGCTATACCACAGTG
CCAGCCCTAAGGTGCAGTGGCACCTCCCATATCAGATGGCCTGGATTTGTGTCCCAGCTC
TGCTTTGGATTAGCTTCCTGCTATTGTGTACCCTGGGAGGCAGCTTGCTATGGCTTGAGC
ATTTGGTTCCCTGCCACCCATATAGGAGACCTGGATTGAGCTCCTGGCTGTTGTGGGTGT
ACGGGGAGTGAATCAGCAGATAGGCGATATTTTTTTTCTTCTCTTTCTCTCTCTACCTGC
CTTTCAAATAAACAAAACTTTCAATTTTTTTCCTCACTAGGCAAGCTTTGTTGCTTCTGA
AAATAGAACAGACATTTCTCTGGATGACCCCAACTTTTGGCAAAAGTGGGCCAAAAAGGC
TGACCTAGACATGGATCTGCTGAATAGCAAGGTGAGCTTAAGTCTTCCTTTAGGGAAGAA
ATACCTCAGAAGACACAAAACTTTTCAGGATTCTTTGTTGCTTTGTTGTTTAGATGGCAT
ATTATACAGAAGGGCTGGTCTGGAAACATTCTAACCCAGGAGGCCTCAGAAAAGTACTTA
GAAATCTACCACTTACTTTTGCTTCTTGAAGATTATTTTACATGTCCTTGAAATATCTCT
TTGGATATCTGCATATGTTACATACCAGGCTATTTCAAACCTTAATTGTCTTTAATTATT
TTCTTATGAGCATATAATGAAGAGAGTTTCTTCTGTCTGCACAGAACAATTTGGTGATTG
ACACACCTAGAGTACGAAAACAGACCCGCCACTTTAGCACGCTGAAAGATGACGACCTAG
TAGAGTTCTCTGATTTGGAAAGTGAGGATGATGAGCGGCCACGCTCCCGAAGACATGACC
GGCATCATGCCTATGGGCGCACTGACTGCTTTCGGGTGGAAAAACACCTGCTGGTATATG
GGTACGAACTCAGCTTACCATGAGAGGTGCTATATCTCCATCCTGACTGACACCCTGCTT
GTCTTTCAAATTGGAGGCTATGACCAAAGAGGGGACAATCAGATTTTTGCTGTGGAGGGA
GTTTACTCCTGTTACTCCTTTACTGTGTTGTTCAAGATCTTTTAATCTCTTACCTTTTGG
AAGATGTAATTCTTGCAGGTAGGGGAATATTGCTGAATTAGCATTTCCAGAAAAATATTA
ATATAGTTTTATTTTCTGTTTAGTTGGGGACGATGGCGAGATATTTTGTCTCATGGACGC
TTTAAGCGACGTATGACTGAACGAGATGTGGAGACAATTTGCCGGGCCATCCTTGTCTAC
TGTCTTCTACACTACCGTGGGGATGAAAATATCAAAGGCTTCATTTGGGACTTGATTAGC
CCCGCTGAGAATGGCAAAACCAAAGAATTGCAAAATCATTCAGGTAATTACCAACTCTTT
ACTTTTCATCTTTTTGTCGGTTATCTAGTCCCTTTTCAGATCCAAGGGTTTTTCTCAATC
CAAGTCTTTGATGTCTCCCCTTTCCCAGGTCTATCTATCCCTGTGCCCCGTGGACGCAAA
GGGAAAAAAGTAAAGTCACAAAGTACTTTTGATATCCATAAGGCAGACTGGATCCGAAAG
TATAACCCTGACACTTTGTTCCAAGATGAGAGTTACAAGAAGCACTTGAAACATCAGTGT
AACAAGTAAGAACTGAATTTCGTGAAGAAATTTCCCAGCTCAGACTTTGTGCACTGATAA
TGAGCTATCTTTCTCCTTCCCTTCTCCTAGGGTACTGTTGAGGGTACGAATGCTATACTA
CCTGAGGCAAGAGGTTATTGGAGACCAAGCAGAGAAGGTGTTAGGGGGTGCCATTGCCAG
GTATAGTTTTTCTGTATTTTTCTTTATGTTCTGCCTAATTCCAAGAAAGGTTGATTTGCT
TATTTCATTCTGTATTTTCCTTGGGATACCTGTTAGTTTAAATCTCTATACATCAGGTCT
TTAATCCTATATTTGACTCTAGTGGTAGGAAATACTGATCATTTGAATTAATGGATTAAG
GAAAATAGCTATATTAATCTTTCTGAGAATTATCACTTTAATTTCTGCATTGCTTTGCTG
ACTCTGCCCTCCTGTATCTTTAGTGAGATTGACATATGGTTCCCGGTAGTGGATCAGCTG
GAAGTTCCAACAACATGGTGGGACAGTGAGGCTGATAAATCCCTCCTCATTGGAGTCTTT
AAGCATGGTAGGTATCTTCCCCTAGTCTAATTTCTTTCCTATTTAAGATTTATGTCCACA
GATGAAACATTTAGCAAAAAAACTCAAGAACAATGAGTCCTCTGACTGATGTTCTATAAA
TTATGTTTGAATAGGAGCAGAGCAGTTAGATGCTATAAATAAATGTTCAAGAAAGGCCAG
ATGGATAGTTAAGGCGGGGAGCCTCCCATTGGTTCTATAATCACGATCAACAGTATGATA
CCCCACTGTATGTTGTGATGCTATGTTGAGGTTCCACAAATCAGGGGAAGTAATATATGC
CCATTCCTGTTAGTAATGACCAGACTTAATTTGTATGACTTTCCTGTAGCTTGTTGAAAA
GTGTTCTACTTATCTAAGTGGCCCAGTTGTCTAAATGTTCAACATTCAGTCTAATGTAGG
TGTGAGCAGCAGTTTTTTTTTGTTTTTGTTTTTGTTTTTTTTTGACAGGCAGAGTGGTCA
GTGAGAGAGAGAGAGAGAGAGAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCA
ATGGCCGCCGCTGATCCGATGGCAGGAGCCAGGTACTTATCCTGGTCTCCCATGGGGTGC
AGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGAGCTGGCC
TGGAAGAGGGGCAATCGGGACAGAATCCGGCGCCGGTGTGCTGGTGCCGCAAGGCGGAGG
ATTAGCCTAGTGAGCCGCGGCGCCGGCCGAGCAGCAGTTTTTGAGTTAAAACAAAAATAG
AGTATAAGATCACAATATACTCAGTTTTGTCTACTAACAAATCGCAGGCACTAAAAGCAT
TGAGTACTAATTTCCAGCACAGTGAGTTCATGAATGGAAACCTTTTCTTTTTCTAAAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCAGAGACCCAAGTAGTTGAACCATCACTGCTACCTCCCAG
GGTATACCTTATTAGCAGGAAGCTGGAATTGGAAGTAGAGCTGAGACTTGTAACAAGGAA
CTCTGATATAGAATAAGAGCTTTCCAAGCAACATCTTAACTAGTGTGCCAGATGTGTGCC
CCTCTTTGATTAAATTCATACCAGCAATCACTAATTTAAAGTCTTCATGATTCTAAATTG
CTATAAAATGTCAATTATAATAATACAACCCAACAGCTACCCCCATTAACATTTTACCTA
TATTTTGGATTAAGAGCAAAGTAACACACATATTCCAATTATTCCAGCATCTACATAAGC
ATACAGGCAAAATGAATCTGATTTCCTTCTACTTTTGGTTCTTTTTCTTCTAGGCTATGA
GAAATACAATACTATGAGGGCAGATCCAGCCTTATGCTTCCTAGAAAAGGCTGGCCGGCC
AGATGATAAAGCCATTGCAGCAGAACATCGAGTGTTGGATAATTTCTCTGACATAGTAGA
AGGGTAAGCATTGGTGTTTAGTTCTCTTAAAACTTTGAGCTCACTCTATGAAGCTTGACC
TAAGAGATAACATAACCACCCTTTCTGAACCCATTGGGATTCAAACTTTTAACAGAGTGG
ACCAGCGGATATGGCTTGATAAATTAACCTAAAGCACATGACACCCTAAGGTACAACTAA
GGGTGAAATGTAATGTTATACCCAAGTGACTCATTGAGTAGTTGTTCTAATGCACTATAT
AACATTCTTCTGCACAGCCACAGAAGCTGAAACAACAGCTGATTCTCTTGAAAGAGAGGA
GTCAGGCAGCTCTCACATGTTGCTTATGTGGTATAGCCTCAGGCAATTTCTGCCCTGGTT
TATCATTTTCCAGTGCTGCCTGACACATAAACATATTTATTCCTCCTGGATGCATGCCCC
AATGATGAGTTGCCATGCTAATACTGAGCCACCAGGTAGGGCATTATTGCCCTGGTTTGG
GTGCCAGTGAGTTTAACAAAACTTCTCACATGAAGACCTGAGGGGCATGTGAAATAGTTG
GCTTAGTTAATGAATACCTACCCATGCCTACACAATTTAGAAATTTCTCATTGTTGATCA
CAATTTCAATTTGCTGTAGGACCCTCAAAGGAAATTGGGTCATTTTTCATTGCAAATCAA
TTATTACTGCTCATTAGAACATGGTAGTAAAAACAAAAACAAAAAACATGGACCATTCAA
ATATCATAGTAAAGAGTAAATAGTTGAGAAAGAGGGAGAGGATGGGTTAAACAATAGAAA
GAGCTATAGAGAGGAAGTATTCTGATTAAAGTGTTTGATTTCAAATACAAGCAATTATGA
GTGTCACTTTGTTGGTTTCTTGTAATTTCTTGTTTTGTTAGATGCTGTACCTAATTGGCC
CAAAGCTTAGCACCCGCCCTGCTATTCCTACAATCATGAAATTAAAGACTATTCCATGCT
GGATTGTATGTTTGGCCAGGTCTTCATCCTAGGTCCCTCTTAGTGATAAAAGATATATTA
TTAACATTTGCTTATGCCTCTGGATAATTTTAGGGTTGACTTTGATAAGGATTGTGAGGA
TCCTGAATATAAACCACTCCAGGGTCCACCGAAGGACCAAGATGATGAGGTAAGGAATTC
TCATTTGAGTCTAGCTTTTCTCCATTACTAAATAGTTAAGTCTTCTCCCATTCTCTGAAT
CTTGAAGTATATTAACTTATCATATAAACTAGAAAGGAAAAACCATTTGAGAATATAAAG
TATTCATACAGAGGATTATAAGGCCAACTGGGGGAGATCAGGGATGGCTTTATGGTTGAG
GTGGGACCCAAGTTTGGTGTTGAAGGATATCATTTGACAAATTTCTGAATCTCATCTTTG
AGTCATTAATAAGAACTGATCTTTCTGGTTCTACGTTCTTCTTCTTTTAGTTAGTTGCTT
CCAAATTTCTGTGAGGGTTCCTTTCATTAGACATTTTTTTGACCCTTGGTGTCACAGAAG
GACACACACAAGAAAGTGATTTCAGAGTGCCAACTTCCCCCCCTTTCACTCCCCCCTCCA
TCCTCTGGGGTGGATCTCCTTCTCTAGGGTGATCCCTTGATGATGATGGATGAGGAGATC
TCAGTGATTGATGGAGATGAAGGTAAACCTCTAGGTCAACTAGTATAATTTTGCGTGGGG
TGGTGGGGTTGGGGAATTGTTGACTGACTTGTTTTATCCTGGGATTCCTAAGAGCTGTGC
CTTTGGGTGGGTTGAAATACCAGTATTATCTCTACTACCTTTTCTGTGCTTCCTGTTGAT
TCTACTTTGTTTCTCACAGCCCAGGTGACCCAACAGCCAGGCCATCTATTCTGGCCTCCA
GGCTCTGCCCTAACAGCTAGGCTCCGGCGCCTTGTAACAGCCTATCAGCGCAGCTACAAG
AGAGAACAGATGAAGATAGAGGCTGCAGAACGTGGGGATCGGCGACGGCGGCGTTGTGAA
GCAGCCTTCAAGCTAAAAGAAATTGCACGACGTGAGAAACAACAACGGTAAAATATGACT
GGGTATTTGGGCTGTGCTATGTGAGCCCTATACTACGAACCATCTTAGGAAGGGTTATTT
GGAATACCCTACCGAGGGATCACCTTTTCTGCCTTGAACTGTTAACGCCTGTAGAACTTA
AGACCTAACTTTTGTGTAATAATCATAAACCTCAGGACTGTATAGACAGTCTCATTAGTT
ATTTGCCTGCCTCATTCCCACCCACTCCCCTCTTAGCTTGGTGATTCTTATGTGTTAATA
TGACCTCACCTCTCCTTCTAGACTTTCTCTTCTTCTGCACCCCTCCCCCCACTGTAATAT
TTGAATCACTCTAGGAAGTGGCCAGTTTTCCTATGTTCTCCTGATCACGGTTGCCTTACC
CCTCTTTGTAGATGGACAAGGCGTGAACAAACGGATTTCTATCGAGTAGTGTCTACCTTT
GGTGTGGAATATGACCCTGACACCATGCAGTTCCATTGGATCGCTTCCGCACTTTTGCCC
GACTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGTCCCCAGTCTGGAGGAGTCTGACTTTA
AAGCTAGAACATGAGGTGGTGGCCAGGAGCCGACCAACCCCCACAAGACTATGAGGTGCG
AGTGGCCCCCTCTGATACTACCCCTTTGGTTTCCCGGAATATTCCGCCAGTCAAACTGGA
GGATGAGGATGATTCAGACTCTGAGCTGGACTTGAGCAAGCTGTCACCATCATCCTCTTC
TTCCTCATCCTCATCCAGCTCCAGCTCCAGCACTGATGAGAGTGAGGACGAGAAGGAAGA
GAAGCTAAGTGAGTACATGTGACAGGCTGTTGGCCCTCTTCCCTGTTTTCCCTTCTGCTC
TTTCCCTTTTCTAAAGGCAACCTCTTGAAAGAGATTTGGGTTTTGATTTGATAACATGTA
AAAAGAGATCTGTTTGTCTTTGGGCCTTTATTCAAAGCCCGTATAATACCATTCCCATAT
AACATGACTCTCCTATCTTTGCTCATACACTCCATGTGATCTCTAGCTGCGGACCATTCC
CGCTCAAAGCTCTATGATGAAGAGAGTCTCCTGTCTCTTACTATGTCCCAAGATGGATTC
CCAAATGAAGATGGTGAACAAATGACTCCTGAGCTTTTGCTGCTGCAGGAAAGACAAAGA
GCTTCTGAGTGGCCCAAGGTAATAACAGCTTCATTTCTGAACATGCAGATCCAGAAACAG
AGTGGAACATTATATAAAGGGAATAAGGAAGATGGTTTTGGTTTATTTTTATGTTTAGTT
CTGGAAGTTTTTGTGTGAAACTTTGCAGTTGGCTTGCTTCTTTCTTGTGATTACCCATCC
TGGTAATGACAACAGTGTTGTGTGTCAGAGGATCATGTAGCCAGTACTCAGACCCTTCAG
TGGTATCTCTTTTTCACCTCCCAGGATCGTGTCCTGATAAACCGTATTGACCTCATCTGC
CAGGCTGTACTCTCAGGGAAGTGGCCTTCTAGCCGCAGGAACCAGGAAATGATCACAGGA
GGAATTTTGGGGCCAGCCAACCACTTGCTAGAGAGTCCCTCATTGACCCCTGGAGAATAT
GGTGATTCTCCAGTCCCCACACCACGGAGCAGCAGTGCAGCTTCCATGGCTGAGGAGGAA
GCATCTGCAGTAACCACAGCAGCAGCCCAATTCACCAAACTTCGCCGAGGCATGGATGAG
AAGGAGTTTACGGTTCAGATCAAAGATGTAAGCTCACTACTGCAAAGTGGGAAAGGGGGC
TGTTCTGTTAATGAGTTTCACTAAAGGGATATAAACTCATTTGGTTATCCAACTTTAGAA
ATGAGAGGAGGAAAGCAATGAGAGCTCACAGAGATCCATTTAGGAAGTCACTGAAGTAAG
GGAAGGGATCTCTTGAGGACTAGATGAAAAGAAACCATATTTTTGAAGGAAATTTAATTG
ATACAAGACTCTTGTTGGCTCATTTCTATATATAAGCCTAATTTTTTTTGAGAAAAAATA
TTTATTTGAAAGGCAGAGTGAGACAGAGATCTTTAGTCCACTAGCTTACTCCCCAAACAA
CCACATATCAGCCAAATCTGTGCTAGGCTAAAACCAGGAACCTAGAACTCCATCCTGGTC
TCACACGTGGGTGGCACGGCCCTAAGTGCTTGGAGCATCATCCACTCCTTTCCCAGATGC
ATTGGCAGGGAGCTGGATCAGAAACAGAGCAGCTGGGTCTCAAATTGGCACGATGATATG
GGATTACAGCATCGCAAATAGTGCTTGACCTGTTGTGCCACAATGCCAGCCTCTGAGTTT
TTTTTTTAAAGATTTATTTATTGGTTTGAAAGAGTTAGAGAGCTCTTCCATCTGCTAGTT
TACTCCTCAGATGGCTGCAACAGCCTGACTAAAGCCAGAAGCTTCTTCCAGGTCTCCCAC
ATAGACAACAAGGGCCCAAGCACACAAGCCATCTTCTGCTGCTTTTCCCAGACCATTAGC
AGGGAGCTGGATGGGAAATGGAGCAGCCAGGTCTCAAATCAGTGCCCATATGGAATGCAA
GCCTTGCAGGCAGTGTCTTTACCCACTGTGCCCCCTAAACCCGATTTTTAAAAATGAAAT
CAAATTATGAGAAAGCTGGTAAAATAATATCTGAAGTATTGAGCCTTATTAAAATTAATT
TCTGAATCATTCTTTGTGAAATTAGTGTTGATTTTTAAGTGTTTTATAGATAGAAATGTT
TATTCTTTCTTGATCCCCTTCCTAGCCAACCTTATGGTTTCTTAAATTAGTATGTGAAAA
GCACAGCAGAATTTTGCCCCTGTGATGAGTTGCCATGCTAATACTGAGACACCAGGACGG
GAGTTTTACCCTGCACTGGGTGTTATTGAAGTAAACTATACTTCTCGTCAATCTACCTGA
GGGGCACTAGGTCCAAAAATGAGGTCTTTGGGAAGGAAGATGTGTGTTAAGTGTGTTAGG
AGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAGGCTGGGGGCTGGAAGACTG
ATGCCATCTTTGTCTTAACTGTATAGAACAATCTATAAAAAAGATTTTTCCTCCAGTATT
GCCTATTTTTATCCCAAGTATTTTTGCAACTCCCTTACAAGGTCAGTTGACAACCTTAAG
AAAGGCTAAATCACAGGAAGTCACAGCACATAATATGACTTGACCAGTACAGAATTCTTA
GTGCAGAATTGACAGTGAATCTAGCATTGTTATTACCAAGACCTGTAGAGTTCAAGCGTT
ATTACAGTTTATTTAAAAAATCCATAGAAACTAATATTATGATGTTTGTTTTATAAAGGT
ATGCTCCCTTATTAGATGTTAGGCTTAGCTTGGGAAACAGTGCAGAGAGGTACCAGTTGC
TATAAGCATTTAATCCCAGTTAACCCCATGTTGTGCTAAGGCAAGTAACAAAGCAGAGGC
ACTAAAAGTAATAATTTCCAACTTCAGTGAACTTAATCAGTATCTGTAGTCAGAACCATC
CAGAAGAAGCCATTTAAAATTCAGCAGATATATGAATATGGTGAGGAGCTACCTATTATT
TTAGTGTTCTAGGTATGTAGAAGTCTCCTTATGACTGTCTTGAATTTATCCTCTGAGGTG
TAATACTAGAGAGTAATACTGTAAATATCAATATAGTCATGCTGTACTTCATGTATTAAG
ATCATGAGAGTAACCTGCTTCAATAGACACTTAAGTGTGCATGTGCTGACTCATTCACTG
CCTTACCTATACCCCTTATTAACAAAAGTTGCACATTTGAAATGGTTGGCTGGAGTAAAG
GTATAATATAGTCCCTGGGGGGAAAAAGCAATAATCTCTGGTTCACATATCAGTATCAAA
TCCTTAATCTTAGCTTCAGCATCATAGTTTCCACCAGCTGAGTCCAGCATTTATTTCCTG
TTCCCCATTACCACTAGACAAGCCTAGTGCCATAATACTTGTTTTACCTCGTTTATGACA
GATTCAGTAAAAAAAAAATTGTGAGCTAGGACTCCGCTGGCATCTTTATCTTCTCCTCTC
TCTCCTGCCCCTTCTTTCTTTTTACTGTCTTCTGTTTTTTTTTCTCTCAGGGTCACCATG
CTGAAACTGTGTTCAACCGGGTTTTGCCAGGGCCTATTGCACCAGAGAGCAGCAAGAAGC
GGGCCCGCAGGACGCGACCAGACCTTTCTAAGATGATGGCCCTGATGCAGGGAGGAGGCA
CTGGGTCCTTATCTCTACATAACACCTTCCAACACAGCAGTGGTGGCCTACAGTCTGTGT
CATCTCTGGGTCACAGCAGTGCCACTTCTGCATCTTTGCCTTTTATGCCATTTGTGATGG
GTGGTGCAGCATCATCCCCTCATGTAGACTCCAGCACCATGCTTCATCACCACCACCACC
ACCCCCACCCCCACCATCACCACCATCACCATCCAGGCTTGAGAGCCACTGGCTACCCCT
CTTCACCAGCGACTACCACCTCTGGTACTGCCTTGCGGTTGCCATCACTGCAACCTGAGG
AGGATGACGACGACGAGGATGAGGAAGATGATGATGATTTATCTCAGGGCTATGATAGCT
CAGAAAGGGACTTCTCACTCATTGATGACCCTATGATGCCAGCCAACTCAGACTCCAGTG
AAGATGCTGATGACTGAAGCCTCAGCATGGTCCCCATTGCTTGGGTGGCTGCTGTATTTT
CATTTACTCTGGCCCTTGGACTATGAAGAAATGGGAGGGGCAGGGGAGATGTGGGGAAAC
CCAGGACTCCAGGAGGTGGAAAGGGAAAAAAATCAAAACAAAAAAAAAAACCTGTACCTG
ATTGCTCCCAATTTTGAGAGGATCGGGTGGGCAGGGGAACTCCTAAAATAATACATGACC
ACTTCCTCGTTGCTGGGGAAGGAAAGGAGACTAGAGCTGCTGGTGCGCTCACCCCTCCCT
AGACACCTCCATTAACCACAGACTATGTAGCGCTGGCCCTCGCCTCTGGCAGAGCCTGTT
CCTGGCCGAACTGTGGATACAGCTGGAGGGTCAGGAACTGTTACCTTCCTTCCCCTTGGC
ATTAATAAATTTAAGTTAATCCTTTTCCACTCTTCCCTTGTTCTATATTTGCTCAGGATG
AGTACTGACTTTGAGATGATGTTCATGGTGGGTAACTTCAACACCACTTCCCTGAAGTTA
GCACTGTTCATACTAAATTACCTTGGACCGAACACTTCATGCCATATGTAAATGCAAATG
CCCAGCTTGCTAAACACAAGGGAATGATTTAAGGTGAAAGGTAAAATGTTTCAAACTTCC
GAGTTCGTTCTTAGGAAAAGGAGAACCAAGAATCTGTCAAGAATCTCGTACATTCTCTCC
CTACTGCACTGAAATAGTGGTGCTTTGGGGGAAGCTGTGGAATGGTGCCGCTTCTCATGA
GCCGCAGTGAGGGGCACTAACTGAAACGATGCTCCCACGACGTGGGCTCGGGGTTATAAG
AAAAAACCATGAAGGTTTGTGGAGCCCTCAAGCCATCTCTGTTAACCTCCCACCTTTCTA
CGATCCCACCGCTCAGATAAACCCTGGGCACTTTATTTTCCTTTCTGTGGCCAAGTGCTC
TCCCTTCGCACGCGTTGTAATCTGTCGCGAGGCTGGGCGCCTCAGCCCTCTCGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1372, 2005..2307, 2309..2388, 6255..6369, 13078..13260, 13343..13411, 13771..13826, 14336..14453, 15845..15928, 19145..19282, 21155..21276, 21422..21665, 24416..24592, 25483..25626, 25896..26151, 26609..26819, 27052..27247, 28113..28280, 28814..28996, 29000..29002, 30160..30270, 30584..30780, 31043..31242, 31348..31504, 31590..31679, 31943..32046, 33833..33962, 35013..35088, 35547..35601, 35779..35986, 36371..36455, 36458..36578, 36726..37186, 37188..37240, 37242..37447, 37669..37817, 38064..38366, 39704..39817, 39918..40097, 40198..40314, 41510..42076
1001..1372, 2005..2307, 2309..2388, 6255..6369, 13078..13260, 13343..13411, 13771..13826, 14336..14453, 15845..15928, 19145..19282, 21155..21276, 21422..21665, 24416..24592, 25483..25626, 25896..26151, 26609..26819, 27052..27247, 28113..28280, 28814..28996, 29000..29002, 30160..30270, 30584..30780, 31043..31242, 31348..31504, 31590..31679, 31943..32046, 33833..33962, 35013..35088, 35547..35601, 35779..35986, 36371..36455, 36458..36578, 36726..37186, 37188..37240, 37242..37447, 37669..37817, 38064..38366, 39704..39817, 39918..40097, 40198..40314, 41510..42073
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved