Oryctolagus_cuniculus Locus TBRG4
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus TBRG4
Oryctolagus_cuniculus
TBRG4
GeneScaffold_3009
SNORA5
2484..2617
7285
AGTGCGTTAGCAGGGAGCTCCACCGGAAAGAGGGCAGGTGGCGTCTTAGCTGCTGCGCC
ACAAGCTGGCCCGGGGAGGTGCTGGGGCTGGTTGGTTGGGCGGCTGTGCTCGTTGATGTC
AGAGCGAGAAGTGAGTAGATTGAGATGTGATCCCGGGGCTGTGCCTGCTACACCACAGCG
CCGGCATCCCGTATCGGCTCTGGTCTGAGTCCCGGCTGCTCCACTTCTGATCCAGCTGCC
TGCTAATGAGCCTGGGAAAGCAGCAGCAGATGGCCCAAGTCCTTGGGCCCCTGCACCCAC
ATGGGGACCGGGAGGCAGCTCCTGGCTCCAGCTCGGCCCAGCTCTGCCCCTTGCAGCCAG
GAGGTGGAAGACGTTTCTCTCTCTCTGTGACTCTTGAACAACAACAAAGAAAAGCTGTGA
CCACCGTGGTTTGGGCGGTTCACTCCGTGTTTGTGTTGTTGAGGTCTACACACGGAAGCT
CCAGGAGCTGTGTGTCCTGGGCTCTCCGGGGTTCTGACTGACGGCGTGTCCTCTTGTCTG
GGAGCCAGTGACCCTTAGTCCTGGTTACCATGGGCTACGTCAGTGCTTCTCGGGCGTCGG
CAGACCCCCCGCAGGCCTCGGGCAGACCTGGGAGTCTGAGGCGCTGGCCCCCTCCTCGGT
GGACTGGAAGCCCCCCAGCCGCGCTGTGATGCTCTGCCCTTGGGTCTGTGCGCTCCATAC
CGAAACAGACGCCCTCGATTTTTGCTCCAGACGATACTGTCACGTACGCGGGGCTAGTAT
CTGAGAAGGGGCGGGGCGGGGCGGGGGGGGGGTAAAGCTGGCTTGCAGAGCACGGCTGTG
CCTCCGTTTCCATTGTGGTGACTCGGGACGGCCCTTTCTGCTTAGCACGGCTGTGCCTCC
GTTTCCGTTGTGGTGACTCGGGACGGCCCTTTCTGCTTTCTCCCTCCAGGGCTCTGGAGT
CGCTGTGGTAGAAATCTCCCCGCCAGGCCAGCCCGGCCACCATGGCTGCCCGCCTGGTGA
AGCGGTGCACGTGCCTCCTGAGAGAGGCCGCCCGCCTCGCCCCTGCCGCGGCCCCGGTGA
GCCGGCTTCGCCTTGCCGGGGTGGCCCAGAAGGCCCTGACCTCCCCGGCCGCCTGCTTCA
GCTCCCACTCCCCGGGTTCCTTGACGGAGCTGGTGGAGAAGGAGCAGGTGTTCACCCCCT
ACCCGGAGCACCCGGAGGTGGACCAGCTCATCGAGAAGGCCACCAGGCCGGGGCAGCTTC
TGGAGCTGCTGGGTGGCGGTCACAGCCTGCACCACAACCACCCGGCCATCATGCTCATCC
GACTCACTCGCCTGCTGGCCGAGAAGCCGGAGGACAAGGCCTCGCTGAGGCAGGACGCCC
GCTTTCAGCAGCTCCTCCAGCTGGTCAGCAGCCAGGTGGGACTTCTCGGCTCGTCCTCAC
GGGCCCTCACCGGCCTCGGTGACAGCCGGCGAGCAGGGTGCACACGGGGGACCTGCGGCA
GGTGAAGCCCGACTCCGCTCTCGGGCTGTAGTTGTGCCTGGTGTGGTTGACGCTGGACGT
TGCGGTGCCGGGTGGGAGGAGGGAGCAGTGGGAGCAGAGCGTCTGCGTGCGATCCTGTTT
CCTGCTGTGAGACTAGGGTGGCGCTGGCTTGTCCGCTGTCACAGGTGGCAGGCGGGGGGC
TGGGGACCCGTGCTGGGACGCCAGGCACATCTGTCTCCCAGGAGGGCGGGGTGGGCCCAG
ACACGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
TTGATGATGAAGGCAGGGCACCTCTCGGAGTCGCTGATGAACCGCCTGGAAGACAAGGTA
CGGGGCTCACACGCCTGGCACCCAGCCGTGCCCTGGGGGCTGTGCAGCTGTTCCCTGGGT
GACAGTCCTGTGAGGCAGAGGGCTGCGGGTGGCCACTCTGTAACTGTGAATCCAGCACGG
CGTGATCTCGAGAGGCAGCAGAGCAGACGTCCCAGCAGTGGCCCAGAGGCACTGGCCGGG
CACAGGCCAGCCCTGGGCGGCCCCTGCAGTCAAGTCAAATTCAGCCCCGGCCTGTGGTGG
TGTGGGCTGGCCAGGTGGCTGCCACAGCGAGCTCTGCAGTTCATGGGCCCCAGGTCCCCC
ACTCTGGGGCCTGGGGATAAGTTTGGCTGCGGACAGGGGTTCTGGGCCCAGGGCGGGCGG
GAGGCTGGCCCTGCACAGCTGAGCCCATGCTGGGTCAGCTCAGGCCCAGTTGCTGTCTCA
CAGGGGCTGCACTGGATGGGACCCCTGCCCCCAGCTCGTCCCCGCTGCCTCTGGCCACCG
GGCTGACCCCTGCACGGCTGTGGTTGACAGTGCCTGGAGCTGGTGGAGCAGTTTGGCCCC
GAAGAGATGAGGAAGGTGCTGGTGACGCTGGCGGCACAGGGCCGGCGGTCGGTGCCCCTG
CTGCGGGCCATCTCCTACCACCTGGTGCAGAAGCCCTTCCCGCTGACCAAGAGTGTGCTC
CTGGACCTGACCTACGCCTACGGTGAGGCGCTGGCTGGCACGCACCTGCAGCCGTGTCAA
ATTCCGCACCTGCCTGCCGTGGCGGACGCTGGCCCAGAAGGCTGCCACAGAAACATGCGG
CTCATGGGCCCTGCCCCGCACTCGGGCTCGGGATAAGTTTGGTCGCAGACACGGAGCTCT
GGAGCTGAGGGCACGTGGGTCTAAGTCCGTGCTCTGCTCTGTCTCGGAAGGCAAGCTGAG
CTTCTACCAGACCCATGTGGGCCCAGCGCCTGGGCCACTGACCTGCTGCCACTCCTGCCC
AGCCTGACTCTCTGCCGAGGTGGCCCGCTTGCGCCAAGTCCTTCGTCTTCATCAAGTGGC
TCAACCTGCCCCTGTTCGAGGCCTTTGTCCAGGTGAACTGCGAGCTGGTCATGGGTTCCG
TGGGGAGCCAGTGGACCGGGGAAGCCAAGCTGGTCAGGGAGGCTCACAGGGCTGCCAGTT
GAGATGTTTCAGCTTGTGTGGGAGAGGCGCTTGCTGCTCAGTGGTGGACACGTGGCGCGG
TCTCGTGTTCTCACTGAACGTCCTGCTTCCACGAGGCTGGGGCTGAGGGTCTGCTCAGAA
CCCTCCTGACCTGCCGCCCACCCCCGAATGGACTGTGTGGGGAGACGCCCACGTGTGCCT
CTCCTGTCACTGCCCTCAACCACCTGTGCCTGCAGTTCAGGGGCACTCATGGGGTTGGGG
GGGGACAGCCCTGGCCACCCTCAGACTCAGAGCCAGGCAGGGGCAGTGCTGCCGGCTGGG
AGCTCATCCTGTCCTCTGCCGCCCCTGACCGGCCCAGCACATCCTGAACAGAGCCCAGGA
CGTCACCCTGCCTCACCTGTGCAGCCTGCTGCTGGCTTTTGCCCGCCTGAACTTCCGTCC
AGAGCGAGAGGAGGAGTTCTTCAGCCTGGTACGGCCCCTCGTCCCCCCAACCCCTTCCCA
TTGGCTGCCGCCTCAGGCGCTCCTCTCCCAGGAGCGCGCGGGGTGGGGCCCCTCCTCACT
GCAGGGGTTTCCCCGCCAGGTGCACGAGAGGCTGGGGCCGGCGCTAGCGAGCCTGGAGCC
GGCTCTGCAGGTGGACCTGGTATGGGCTCTGTGTGTGCTGCAGCAGGTGCGGGAGGCACA
ACTCCACGCTGTCCTCCGCCCTGGATTCCACAGCCCGCTTCTCGGTGAGCCGCAGGCTGC
CCTGCTTACGTAGAGCCGGGGAAGGCCGTGGTGGGTTCCCAGCCCGTGGCCCTGTTCCTG
GAGTGCCTGTGACCACAGGCCGTGGCTGCTGCCTCCTGACCTCGGCGCTGGGCGGGGTGG
TGGCCACTGCCTGCCCTCTGGGGCTCCCTCCGCCAGCCCGCCTCCCTCCGCTGTGCTCCT
CCCCCAGGGGCCAGGTCTCCTAAGGACCAGAGCACCTTCCTGAAGCTGCTGCACATCAAC
GCCACGGCCCGCCTGGAGCACCCCGAGTATTCCGGCCCCCTGCTGCCGGCCCTGGCCGTG
GCCCCCAGGCCCCCGGCCCCCGACCAGAAGGTGACCCCCTTGCAGAAGGAGCTGCAGGAG
ACGCTGAAGGGGCTGCTGGGGAGCGCCGACCGGGGCAGCTTCGAGGTGGCCACGCAGTAC
GGCTGGGTGCTGGGTGAGCACACCCCCAGCTCCCCGGGGCCTGAGTCTGAATTAGACTCG
TCTAGCGCTGCCCTCGTGGTAGGACCCATCCAGACCCTGGGGTTCCTGTCCATCCTTCCT
GGGGTGGGGGAGGGGACGGGGCAGCTCAGGGACCTGCCACGTGCGCTCACACGCGTGCCT
CCCCAGACGCAGAGGTGCTGCTGGACGCCGACGGTCAGTTCCTGCCTCTGAGGGACTTTG
TGGCACCGCACCTTGCCCAGCCGGCTGGGGGCCAGCCGCTGCCTCTGGGAGCTAAGAGGT
GGGTGGCCAGATCTCTCCGGTTGCCGCTCTGGTGAAAGCCACGGGGCTCAGCAGCTCTTG
ACCTACGCCGCAGGTGGCTCTCTTGTCTCTGCTGTCTCTCTCTCCTCCTAGGACGGGAGA
GGGAGCACTCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCCTGTGATTCCTGTCACCCTTT
AAAATCCAGAAGCTTCCTTGGGCTGGTGGTTTGCAGACCCGTCTGGCACTAACAGCCAGA
GCCTCCCCCACGCATTGGCTGCAGTGCCAGGGCGGTCCCTGAGGACAAGGGGTTCAAGAG
GCAGGTGTGCAGAGCCAGGGGTCACCCAGGAGGCCCCCACCACATGACCTGTCGTCCCCT
GCAGGTCCCCTACTACGAGTGGCTGGAACTCAAGTCTGAATGGCAGAAGGGCGCCTACCT
CAAGGACAAGATGCGCAAAGTGGTGGCCGAGGAGCTGGCCAAGTGATGCGTGGCGCCGGT
GTGCACGGCACACCCAGGCCTGGCTCTGGACCCCTGGTGGGCAGGAGGTGGCATCTGAGC
GCTGGGCCTGCTCCGAGTGAGAGTTGCCCAGTAGCTCAGGGACTTGCAGTTCCCTTGTGG
GCAATAAATTAAAGAATTCATTGTCACTGTCAGGAGGCTCCCGGGCTTTGTCACCTCACC
TGTCACCTGTCTGCTTTGGGGGCGGGGAATGGCTTGTGAGCACCCCAGTGGCAGCTGGAG
GAAGGCAGCTCCTGACTGCTCAGTGCCCGAGGGGCCCCTTCCCGGCGTGTGTTCTGCACC
CACACAAGCCAGCCAGTACCCGGGCTTCTGCGGTTGGTCCCCACAGACAGGGAGCCCTGG
GATCCGGATCCAGGGCTGGTTACGAGCTGTGGTCCCCTGGGAGGCCCTGCAGAAAAGCCC
GTTGCTGACTCCATGGGACTGGAGGCGAAAGCCATGTGGAATGGCCCAACCAGAGCCTTG
TGCTGCCGTCACAGGACTCTGCCCCAGCAGGGACAGCTGTCCTTTCCGCCCGGTCTCCCC
CAGAAACTAGAGTGGGGCTGAGAGCAGAGGAGGCTGATGCCCGAGGCCGACGCCCAGGCC
TTAGAGCTTTGCCTTCACCTCTGAGCTCTGGCCCCTCACGGGGCTGCTCACCAGCCCGGC
CATGTTGGGGAGAGCAGCTGAGCTGATCCTGTGGGGGAGGCGGGGAGAGCATTCCAGAGT
GGGGGGACGAGCACCAGGGCCAGGCAGTGGCCGAGTTCTTGGTGGGCGTGCCCGAGAGCC
AGCCAGGGAGGTCCTTGTGTGTGTGTGGCTATGACAAAATAAAAGTGTTTACCACTGCAG
GCGGTGGCTTTAATTCTGAGGTACTTACAGGTCCCCTGTCATTGGAGGAAGCACTGCCTC
GTTTCCCGGCAGCTCCCGTGTGCACTGGGTGGGGTCGGGCTGGAGCACAGTGGCGCTGCC
ATGGTGGCTGTAGGTGCCACGTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1414, 1848..2117, 2223..2276, 2790..2961, 3170..3197, 3199..3210, 3212..3248, 3250..3267, 3269..3331, 3757..3867, 3979..4123, 4327..4572, 4746..4857, 5427..5541, 6184..6285
1001..1414, 1848..2117, 2223..2276, 2790..2961, 3170..3197, 3199..3210, 3212..3248, 3250..3267, 3269..3331, 3757..3867, 3979..4123, 4327..4572, 4746..4857, 5427..5541, 6184..6282
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved