Oryctolagus_cuniculus Locus GNL3
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus GNL3
Oryctolagus_cuniculus
GNL3
GeneScaffold_4746
SNORD19, SNORD69
5132..5207, 5662..5738
8038
AACCAAACTATGCTTCCCTTTCAGAACGTAAAAAACTTTGATGGAAAAATATTGTTTAA
AAAACAACAACAGGCTGTTTTCAAACCGCGATTCTTTGTAGTGCAGCGAATGAGAAGCTG
AAACACTTGATGTTTAGCCCCTACTCTCAAATACAAGTCGCAGTCTCAACGAATACTCGG
TCTGAACCGTCGCCCAGAAAGATAAAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATCGGAGGACGTGGCCCGTCCGTCATCGATAGCGGACTAAGGGGCAAGGTT
GACAGCTTTGAAGCTGCCGGGCGAGGAGCGGGAAAGCGTCGAGCGAAGTTTCTCGGGGCG
CAACGCGCCTTTGTCCCGCCCGCCAGGTGAGGCGAGGGCTGCGGGGCCCGTCCCGAGGTC
TTGCCGCCGCGCCCCGCCCCGCCCGCGCGCCCGGCCGGGACCGGCGCGTCCCCACGGCCG
GGGCGGGGCCTCCGCCGCGGCTCCCGCCCGCCCGCCCGGGCCCACACAAAGGCCCGGCGG
CCGGCCGAAGGGGAGCGGCCCCGCCCGCCCCGGGCACAGTCTTACACAGCCGCTCCGCCG
TCTGCAGCCCCGGCCGCGGTCGCCGACCGCCACGCCACGCCCCGTGGCCGCCACGGCTGC
TGCTATTGCTCCTCCGGCCGCGGCCGCTGCCGTCGCTCCGGCACCCGCCGCCCTCACCGC
CCTCACCCCTCCCAGAGCCGCCGCAAAACCAGCCTTGCTGCCGCCAAGCGAGCCTGGCTC
CGCGCGACACTGCGTGCGCGCGCACGCGGAGGAGAGAAGGCGCGCTTTACGACGGTAACG
TGACTGCGTGACGCTGGTTCGTGGCCTCAGTTCACACGTGGCGCTCGCCGAGGAAGGTTG
CTGCTGCTTCGTTCTCTGCCGCCGCGGTTTCCGCAGCCAGCATGAAGCGGCCCAGTGAGT
GGGATCGGCAAACGGGCTTGCAGGCGCCTCTTTTTCTGGTGGTTCCTGAACGCACCAGGG
CGTTGGTCTCTGGGAGGTTGGGGCCTGCTGGTGGGCCGTTGCCCTGCTCCCGGTATACCC
GAGCGTTGGGCGGCCTCGTGTCCATCCTGTTAAGCCCGGGCCGAGGGTGGAGAAGATCAC
GCCATATTGTCAGGAGACCGCGACTGAGCCAGGTGGCAGGCGGCGTGCGGGCGGGCTTGC
TGAGCGGGGGAGCCGCTTCCCAAACCCACTGTTGCTCTCCTGCTTTATGATCCGTGGAGC
TTACACGAAGTGGCAGTCGTTTTGGGACTCGTATACTGCTCTATGTGATTTCCGTCTAAC
ACGGAAACAGCAGGGATTTGGGGCTCCGTTCCGGATCTGGGGATTTGAGAGTAGCATCTG
TGTTTTTATTCAGCGCCCCACATGATTCTTAACGTTAGGTTTGACATAATACACAAGGGT
GTGACTCTAGTTCACTCACGGAAAACTAAACCAGGCCGTGTTATGTGTTTCTTTGTAGAG
TTAAAGAAAGCAAGTAAACGTATGACCTGTCACAAGCGGTATAAAATCCAGAAAAAGGTA
AGTGTTGCGCTTGGGAGAGCTGTACTGAAAAAGGCTGTTAAGCCGACTAATGCCCTGGCT
CTCCCTCATCGAGAAGTCTGGAGTAAAGATGGAGTCTTCGGGAGGTGGAACGGGATGGAC
TGACCAAGCACGGCACAAGCTCTCAGTGATCAGGAGTGCAGCTTTGGGAGGGCGCAGTGT
TTGGTGTACGGAAGCCTGGGAACTTCCACGTAGTCATCTCTGCAAGGAGAGCCTCCTAGT
GTCGTTCTGTTGCTGTTTTTTTAAGTATATATTTTGCTGTCTGTGACTCCCATTAAAGAT
CCATTTTTCTTGGGGCATTTTACAGGCATGACTAGGTTGTATGCATATTGGTCTCTTACT
TGAATTGTGTTGAAGTAGAAAGGTATTTTTTTGTAAACTGATTAAATGTCTTGTCATCAT
AGATTCGAGAACACCACCGAAAATTGAGAAAAGAAGCTAAAAAACAAGGTCGCAAGAAGC
CAAGGAAAGACCCAGGAGTTCCAAACAGTGCTCCCTTCAAGGAGGCCGTTCTGCGGGAAG
CTGAACTAAGGAAACAGCGGGTAAGCTGCGGTAGCCCAAACTTGGAGTAACTGCGGAGGG
GTGGGTGCATTTTTTTCAGAGGGAGCTGTTGCCAGCAGTCACTGGCTTAACCTGTCTGAT
GTGTTGGACACAGCTGGAAGAACTAAAACAGCAGCAGAAACTTGACAGGCAGAAGGAGCA
GGAGAAGAAAAGAAAACTTGGAAGCAACCCTGGTGCTAGGCCGTCTGACGGGGAACCTGG
CAAGGAGGTGAGAGTGATAGATGAGTTCTGATGCAGAACTAAAAGCATGTACAGGGGCAG
GGGCTGGTGAGCCTTGAGGAGGAGGAGTGATTCCGATTCTGTCTTACACAATATCACCTG
CAGCGCCTCAGTCAGCTGTGCGGATACAGGTACAGATTACAGCTGCTGCACTGCTGGTTT
TTATGTCTTTTCCCCCTTCTCTGTTTTCTAGGCACTTGGACAATGCACAGCCAAAAACAA
AGCCAAGTCCCGCAAGCAGAATCCAAAGAAGTTACATTGTCAGGAGCTTAAAAAGGTATC
TGAGTCGTGCTTCGGCAGCACATATACTAAAAAAGGTATCTGAGTCTAGGTCAGTGCCTA
AAAGTGGTGAAGAGGTTAAAAGACAAAGCAGCAGTCAAGTTCACTACCTAAGGCCTTGTT
ATGTTTAGCTGACAGCAGTGTGTTGACAGTGGTTTTAAGTTTGAGGTAAGCAGTGTGAAA
ATGCCGGTCTCTAAAGTACTCTGTTGAAGCTTAAGTGATGGAAATGGAGAAAGAAGGTGG
TGTCTTTTTGGTGTAGTTGCTCCCCGGGCTCTCCTCCCTACACCCATTTCCCCAGGGTCA
TTCCCCTCCAGGTGACTCTGCCTCTCATAACTCCTGGTGAGGTCAAAAGGGTTGGCCAGA
CGACAGGATTCCCTACAGAAATGAGAGCAGCAAACAGTAGAGGGTATTTCTGCTTGTGAA
ATCCACGCTGCTGAGCAAGCCTATTGGTTTTACTTCTGGGTGAGAAATGATGAGCATGTC
AGTATTCATACCAAAGTGAAGACATGAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTGGCTGGGCAGTGGGCTTTCCGTGGACT
TTGGCTGTTTGTTACTACCACCTTGTTTTGTTTAAGAATATCCGCTTCTGTGCTCTGCTT
ATCGTGCAGTGTAGCTGTCATACAGAAAGGGATGACAGTGCCAAATTCCCCCACCTGCAC
AACTATTAGTTTTCAACTGAGATAATATGGAACGTATTCGACAAACCATTTGAATGAAAC
AGAATTACGTACAGCAGAACAGAGATGGTGTGAAACAAAGTGGGAGAGAAAAATGGCTGC
TGGCTGGGGTCAATGCTGGAAACGCTGCTCTAGGGTTGGTAGGGTTGGAACCCAGACCTC
TGCCTCAGTCCCAGAACGAGCAGTGCGGGGAGACCTGAAGCACAGGGTTGTAGAGACTGG
GCGCTGTGAGTCACGGGCAGCGCGGTGGGCGCTTCTGTCCCTTCTGAGAAAGCTGGGGAA
GGGCAACCAAGTGAAAGCTCAACTCTGCCAAATTCTGCAAAGTCATCTCACTCACATGAT
CAAATTCATACCCCTAATTCCTGTCAGATCTGGTACCAAAGGAGAATCTGGAGGGCTGGC
TGAACTATTTGAAGCAAGAATTGCCAACGGTGGTGTTCAGAGCCTCAACAAGTCTGAAGG
ACAGAGGGAAGATGAGCGAGGTATACTTCACCGTCAGCGTGGGCAGGGCGCTTCTTCCAG
ATTCCTGACGGTTGGAATATGATGAGTATGCAGAATCTTGATTTTAAAAAATGAAAAGTT
ACAAGATCCAACTCTGATTTCATCCTAAGATTAGCTGAACAGCAACAGCATTTGGTTTTT
AAGGCTGGGGCTCTGGGATCAGATTGCTTGGGTTTTTAAACTGTTTGGGATTTTTACATG
TGAAGGTGAAGAAGAAAGCTCCTCCGGTAAAAAATAAAATCTGCTTTGGGAAAGATGGCC
TTTGGAAACTTCTGGACGATTTTCAGAAGACTCAAGGCAAAGCTATTCAGGTTGGAGTAA
TTGGTAAGTTTCATTTTATCTGATTTCACCTTGTCCAGATACTCAGCCAAGAATTTTTCC
AAGTTAGTAACAGCATTACCATCAGAGTCCTTAATCTGACATTGGCTTGTAGCTCACCTC
ACCAAAAACACAAACACAATTTAAAGGAAAAATATGTAAATACTTACTGCCACATTCAGT
TCGTTGTCAGACTGGGCCCTGTAGTAAACTATTTTCAAAGCTTTTGAATTATTTGAATGA
ATAGTCTTTGCCTACCCTTTCATCACTTGTGCAAGAAATGAGGAAACTACAATTGGTCTT
AGTGTTGAAGTGAAGACACTCAGATCCAACTCTGATCTTGCTGTAAACATTGGGAAGACA
TAAAATTACCAGTACATAATGCATTTACATCTGTGATTTCCCATTTATTTGTAGGTTTCC
CAAATGTGGGGAAAAGTAGCATCATTAACAGCTTAAAACAAGAACAAGTGTGTAATGTTG
GTGTATCCATGGGACTAACAAGGTAAATTGAGCTATTCCATATATTACTGTAGATGAATT
AAAGTTTTACTTTGGTTATCTTGTGAAAGTTGATTATATATTTTTTCTATGAAACAGTCA
GTGAAGAGACTGAGGCCAGTGTTGAGCTTGGGGAAGTATTGATCAGAGTAAGACAGCTGC
CTCAAAAAACTGATGCTTGAACCTGGCATTGGGAACTGAATGGGAGTTTGCCAGGTAGAA
GAAGCAGTGATAGTTAAGCAGAGTAAACAGCCCATGTAGAAGAGAGAAGTGTAAGCTGTA
ACCTGGTTGAGGAGTTTAGATAAACGTGAAGCAAATGATGATAAATTGGATCTGAATGAC
TGTGCGGAGTTTGTTCAATCCAACCCTGAGCTTCATGTTCTGTCTTGTATCCTCCAGAGA
AGCTAGTGCCTCCCCCCATCCACTCCGTCTTTCTTCTTTCAGGACCATGCAGGCTGTCCC
CTTAGACAAACAGGTGACAATCATAGACAGTCCAAGCCTCATTGTGTCTCCACTGAACTC
CTCCACTGCCCTTGCTCTGCGAACTCCAGCAAGTATCGAAGCAGTGAAGCCACTGGAGGC
TGCCAGTGCCATCCTGTCCCAGGCCGACAAGCGACAGGTACAAGAACCTCCTTCCATTGA
GCCCTTCACCATCATTTTTTCATTCATCAGAAGCATTTTAATGAGAAGACTGTCAAACTT
TTTTTTTTTTCCACAACCATACCAAATAGAAGTTCCTGTTGCTTTTTTTAAGGTAGTATT
GAAATACACTGTTCCAGACTACAAGACTCCCGTGGAATTTTTCACTCTGCTTGCTCAGAG
AAGAGGTCTACACCAGAAGGGTGGGAGTCCAAATGTTGAAGGTGCTGCCAGACTGCTGTG
GTCTGAGTGGACAGGGTAAGGCTTCTCCCGGCTGCATTTTGGTGACCGCATGGAGTGAAT
GAATTCTGACGAATGCTGTTTTTAATACCAGTGCCTCATTTGGGTACCATTGCCAACCCC
CTGCATCCTGGACTCCTCCTCCCTATTTTAATGAGAGCACTGTGGCAGACATGAAGAGGG
GCTTTGATCTGGAAGAACTGGAAAGGAACAACGCACACAGTATACAAGGTGAGTGAATGT
TTCGTTGTTCCCGTCAGCTGACAGATGGCTTGTCTCAGGTGTTTATGTTGGCTTTGTTCC
TGTCCCAGCCATCAGGGGCCCTCGCTTAGCCAGTAGCGTCCTTTTCCAGTCTCCATGTAT
GACAAATGGAATATTAGAGGAAAAAGTATTTGAAGAATCAGCAAAACATAGTGGGAGGAA
GCAGGAGAAGATGGAGGACGAAGGCATGGACAGTGACCAAGAAAGTGTTGATGGTAACGT
GAATGTAAGTGTGTTCTCTGAGTTACTCAAAGCTGAAGTGAGTTTTCTGGCATTATAATG
TATAATGAATGAGAAGGGGCTGAAGGTAGAAATTAAATATTTTGCAATTGACTGGAAGAA
GCCCTGTGTACAATTTAGCTGTTTTCCCCATGCCATTAAATAAACCTGCAAGGACTTAAC
AGGTGTGTAGTTACTTGGATTTATGATGTGAAAGGGCCATTGACGCAGCAGCACTTCTTT
GTGTCTCACAGGAAAAGCCCTCAGACACGTCCTCCTCCAGAAGAGATCCGGGAGTCACTG
CCTGATGGAGTCCACAGCAGGTGAGTGGGGGCAAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAACTCACCTAATTCAGTGAGTGTTACAAAGAGTTACCTGGTCTTTCAAG
TGAAAAACAAATTTTATTTACAGATGAGGCCACAGGTTACAAAATTAAAACCAAGCAGCA
GTTCGGAACCAGCTGTACCAGCTGGCAAAACTAGTTCTATCAGCTTTATCAGTCCATTCT
TCTGGTCAGTCAGCACTGTAGTAAGAAACACTTGGTAAGGCAGAAGGAACCATATTTACA
GTCTGTCTGGAACAAGCTGACTGCCAGACAGGCCAATATGTTGCCCAACTGAGCGGTCTC
TTACCAGTCGCTACAGATACGCACTGAAGCCTAGCAACTGTTAACTTCCCACACGTACAT
ATGGTCTTCGGGGATTTCCTGAGAGATTCTTATAGTTTAAATTTTTTTTACTTTATGTTT
GAGATCTCCATATGTCTTCGGATTAAGCTGAACTTGCCTGTTGGATCTGGAACATACCAT
TTTTCCCAAACATCAGTGTATGAAGCGGTTCTTCCCCACGGCTTAAAGTGTCCATTCCAG
TGGAGTAACTTGGCAGCCTTTATAAACTGGGGTGAATATCGTTTTCCAGCACTGGAACCT
TAACAATTGAGAGAAAAAGAACCAGGTGATGGCAACAGTCAGACACAAGACAGTGCCACA
CCAAATCGTAGAAAACTTTAAAAAACAGGTATACTCCCATCCCTGAGAATAGTTCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1558..1616, 2042..2179, 2293..2406, 2611..2688, 2729..2734, 3473..3605, 4407..4519, 4736..4862, 5274..5361, 5802..5976, 6112..6254, 6331..6467, 6548..6723, 6971..6989, 6991..7024, 7026..7038
1001..1013, 1558..1616, 2042..2179, 2293..2406, 2611..2688, 2729..2734, 3473..3605, 4407..4519, 4736..4862, 5274..5361, 5802..5976, 6112..6254, 6331..6467, 6548..6723, 6971..6989, 6991..7024, 7026..7038
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved