Oryctolagus_cuniculus Locus ENSOCUG00000002506
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000002506
Oryctolagus_cuniculus
ENSOCUG00000002506
scaffold_195371
SNORD102, SNORA27
1583..1653, 1946..2074
3775
TCCCGCATGGCGGTGGGACGAGGGGAAAGTACTTGTACCGGGAGGCGGTGTCAGGACAG
CATGTGTTGAGCGAACGGATTCCGGAACAGCGTGCGATTTAGAAGCTGAAGGGAACGTTC
TGTAATAGCCACTTAGTCGTAGTTCTTGGTGGTTTTTGTCTAATTACTTGATACTAATGA
CATTTCAGTCAGCAGACTACCCCACAGTGGATTCTGGTTAACGCGGTTTTTGGTTGCTGT
TCAGACTCCATCATCGGTTTCTACGTGGGGTGTCGTTTTGAAAAACCCACTAAGTTGTAG
GTTTGTTGAGTGTAGATAATAAAATGGATTTCCAACTCTGGAAAGTGGGTCCGGTGGAGG
AGCTCTGGAGTCAGATGCTGTTTCTGCTGTTTTGTGACCCCACCGAGTGGCTTCAGTCTG
CAGAGCAACACTGCTTATGGACTGAAACACGGAGGTGAGATTTTTGAGGATTAGCACAGG
GCATCTGCACCTGGTTGCCTTCTTTCCGATTAAAATTATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTTGAAGTGTAGTGGCTTTGCATTAAATACTAGAAGCTGTCACAGGAAATTAGGTT
GAGATTTAGTATTCCCCACCCCTCCCCATGGCAAGGCTGTTTTGTCAGTTTCTCCAACAA
TAAATGATCTCTAGTGAGTGAAAGATTTGATGCTGCAGTTCTTTCTGACATTTCTTTTGT
GATATAAAAACATTTGAAATCAGAAGGGTTTTGATTACAAGAGACATGCCAATATTTGTA
TATGACTTTTTATGCTTTTCTGAATTCAGTAATTCGCCAAGATGACGAACACAAAGGGAA
AGAGGCGAGGTACCCGGTACATGTTCTCCAGGCCTTTCAGAAAACATGGTAAGTAGATGT
ACCCTCCTTGAGAGCAATCATGGCACACGGTAGTGTTTTAGTAATATGTGTATGTTTTAC
TTCCTGTAATGTTCAAAATGGCCTTAAGCTTATTTTATAATAAATAACAATTTGTGTAGC
AGTGTTTTAACTACACTTTAGTGCACTGATTTTGTTTTCAAGGGTAATTGTCCATTGGCA
AGATTTAAAACTTTGTAACTGTCAAAGGTGGTGTGTGTATATATAGTAACCTTGATACTG
AACCAAAATATTTTTCTGCAGGAGTTGTTCCTTTGGCCACATACATGCGCATTTACAAGA
AAGGTGACATTGTGGACATCAAGGTAATTTATGAAAATATAGAGTGAATGTTTTATAAGT
TCTCTTCTTGGGTCTAGATTTTTCTCAATACCTGCTTGAAGGTAACATTTAGTGGAAAAT
TAAGAAAAAATCCTAAGTTTGTCAAAAGTGAAAGAAAACTCTAATGAAAGCTATTTTGTG
TCTTATGTGTCCTGGTACTCCAGAGCTTAATGATGATTGTCTTTTTGATTGCTTGAAGCA
ATATGAAAAACACATTTCACCGGCTCTGAAAGCTCTTGAGTCACCACTTAAAATCTTAAG
CAGGCCTGATATGGTGCAGTGGGCTAAATCTTCAATATTTTTTAGAATATTTAATAAGAG
TCAAAGTTTAAAAGGAAGGGGAAGTTGTAGTGTAACATTTGTCTCCTTTTTTAACAGGGA
ATGGGTACTGTTCAAAAAGGAATGCCCCATAAATGTTACCATGGAAAAACTGGAAGAGTC
TACAATGTTACCCAGCATGCTGTTGGCATTGTTGTAAACAAACAAGTGAAGTAAGTCATA
GTTCTTTGTACTAATTGATATTCTCTCGCCCCCTTTTCACTTTGCCAATTTGACTTTTTT
GTCTTTATTGGTCATTCAAGTGGGGCAAAGGAACTATCCTTTTAAAACTCAAGCAAGCTG
AGTGTTTGTCTTGTAACCTGTCAGAGGAAACAAACTGAAATTCACTTAATAGAAAAGCTT
ACTTGATTAAGTTCTTAACAGTTCCAGTTTTCATGAATTTGAGAAATTAATCTTAGTTAA
ATTAATGTTCCAGGAGCTGTCATCTCATTAAAAGAGACCTTAAAACTAGGGCTGTTGGCC
AAAAGAAGACTTAAAATTGGTGGTAAATTAAGTAATCAAGCCATCACCCTGTTGATTTAT
ACTGTCAGAGTAAAAAGAAGGCTCATGATTTAACAAATGGAACTTCCAAAGCAGTTTTCT
GTGTCTCTGTTAATACTCCTGACAAAACACTTACCAGATCTTCTGCTCTCTTCAGAGGCA
AGATTCTTGCCAAGAGAATAAATGTGCGTATTGAACACATTAAGCACTCTAAGAGCAGAG
ATAGCTTCTTGAAACGTGTGAAGGAAAATGATCAGAAGAAGAAGGAAGCCAAAGAGAAGG
GTACCTGGGTTCAACTAAAGCGTCAGGTAAGCATTTAACTTGACAGGCTATCTTGGTATT
GATCTTCGGGAACTTTTAAAAATTGTTGCTCACTGGTAAACTTATTTTTCAGAATTAAAT
ATTTTTTTCTGAGTATTAATAATTAATATAATTATTTTCCCAATAGCCTGCTCCACCCAG
AGAAGCCCACTTTGTCAGAACCAATGGAAAGGAGCCTGAGTTGCTGGAACCCATTCCTTA
TGAATTCATGGCATGATAAATGTAAGATAAATAAATAAGACCTAATTGATTAAGGTGTGG
TGTCTTGTTTCCAAAGAGTTATTTTATTCAAGTTTTAACTATGTCCTAAAATAAGTGGAA
GATTATGTTGCATTATAATTAAGCTCAGAAAGTTGATTACTCATGACTCAAATAGCTGGA
TTTTAAGGATCAAGAATTTGCCTTTGAAGCTGACCGTTTAAAAAAATGAGTTGGTTAAAA
AAGTACGATTTGTAACAGCACTTTCACCATTCACAGAACAGGATGCCTTAGACAACAGCA
TAATAGTGTTTATTTTAGTCCATTTCTCTTGCTGTAACAAATTAGCACAAACTTGGGTAA
TTTGTACAATTTAAGTCCATTTTTCACAGTTCCAGAGGGTGGGAAGTTTGAAGATCAGGG
CATGGACCAGGTTGATGTCAGACTGTCCTGTGGCAAAATAGACTGAAGGGGAGTAAACTG
TTCACTTCATGCTAGGAGAGGAGTGGGGCTTCACAGGTTCCCTCCAGCCCTTAGTGCTGA
TGCATTCATGAAGGCGCAGTCCTCAGGAGAAACCATAGTTTATGTTTGCATTTGAAATGG
AAACTAAAGACTCATGTAATGAAGTTGTCTATTTTACTCCATTTTAATTTTTTAGGATTT
TTATTTGAGGGGTAGAGTTGAGGGTCTTATTTGCTGGTTCATTCCTTATCAGGTATTTTA
ATACAATTTATAATTGCAGTTATAACAAGGCATGTAGCTGCTGTGATTTCCTGTTTAAAT
GGTATTTTCACCCCACCACTTGTGTTCAACTTGAGGACAAGAATCTACTTGTTCTCCAGT
TTAGTAGATGCTGTGGGTGGGGGGGGGGGAGCTTAATTGGTGGCTTGAGCTTTCTCTACT
GAAGTAGGTGGGGTAGTAAGTACTGCTTTGGCAACCAGAAAACTTGATTTGAATATCAAT
GAGTGCCTAACAAGGTGAAGTTTTTAACTTTAAGGGGAGTTTAAATGGATGATGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1341..1402, 1797..1909, 2395..2545, 2686..2775
1001..1067, 1341..1402, 1797..1909, 2395..2545, 2686..2772
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved