Oryctolagus_cuniculus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus NOL5A
Oryctolagus_cuniculus
NOL5A
scaffold_177582
SNORD110, SNORA51, SNORD86, SNORD56
2225..2296, 2938..3072, 3922..4007, 4443..4513
7167
TGGCTTGTAAGTTCATTACTTAGCGCGGCTGCAGCATGGGGAGTCGTCGCCCAGAGACC
CCCAGAAGCGGCTCCCGGGCCTCAGGGCCGCGAGCAACACCCGGCCGGCCCCGGGCCAGC
GAGACCGCTCCACGAGGACTCGGGGTCGGGTCGCTCCGTTCCTACACTACCGACCGACAC
TCATCCGGCCCTAGAACTAAGTTACATATAACTCGGCAATGCGGCTGCGAGGAGCCACGT
TCGCGGCGCTGACGGCGCCAGGGCGTCCCGCGTCCCGGAGAGGAGACAGCGCGCAGCCCA
CAGAGCTCGGGGCGCTGTCCGAGAGTGGGCGCCGGGAGCGTGGGCGCGCGGGCGGGCCTG
GAGGCCGAGGGCAGCCACGCGGCGTGGGACGGGCTCTGCGCCCACGGGGATCCTCCTGCC
CCCGCTTCACATATTACGAAAATACGGGCCATCGGACCATTATCCGAAAAAGCGCCCCTC
CATGCAGGCCTGCGGCCTGCAGGGCCTTACCGATCCCGCGTGTCCCGGGCAACCGCGCCC
GCCCGCGCAGCCGCAGAGACCGGAAAAGGCCGGTTCGTCCGCGCGCCGCTCCACCGCGAC
TCGCGCTCTGGGCGATACCACTCCCAGAGGACCCCCTGCGAAGGCTCTGAGATAGTGCCG
TCCTCAGCGCCTCTGATTGGGTCTGACTCGACCGGGGGGGGCGTGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTGCTGTTCGAGCACG
CGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAAATCAGCCTGCTGCTGCCGC
AGGTGAGTGGTCTCGATGGACGCGTGGGGGGTCGCCCGACTGCGCTGCAGCCCCTCGGTC
GCGCGCCCCCGGCATGCACCGCGCGCTCCCACGTGGCCGGCCGCGCGGGCTGGAGGGGCC
GGCCCGGAAGACTGCAGAGGCGGGGGTCCTCAGCCCGTCGCGTGGCCGGGGTCGCGGTAG
GAGCCATTGGAAGTGAGCGTCCCAGAGCAGAGCCCGGCCCCGGTGCGTCTTCCTGGCGCC
CGGGGGCTGACGTCGGCCGCCGGCCGCGCCATTCATTGTCTCGGCAGGTGGAGGAGAGCG
TGCTGAACCTGGGCAAGTTTCACAACATCGTGCGCCTCGTGGCCTTCTCGCCCTTCTCCT
CGTCCCAGGTCGCCTTGGAAAATGCCAACGCGGTGTCGGAAGGTGAGTCGGCGTCGCCGC
CCGGGGTCAGCTGGCTTGTTGTGATTAAGGTGCATTTCACGCATGCAACCCACGATGTAG
GCTTTGGTTTCTTTGAGCATTGTAGTTAGCGATCAGTGGTTTTTTTTTTGGTGGCTGGTT
TAACCTGCACGTGTGCCCAAGTTTGCCTAGACACGATTAGTTGTCTTATTAATTTTCTGC
TGTGTCTTTTAATCTGTCGGAAGGGGCACTTTTGATAATTACAAGGGTGTTGGTCCCAGA
AGGCAAATTGGGATAGGAGATACTATTTGAGAGGTAGAGATATAGACAGGGAGAGACCGA
AAGAAAGATCTTCCATCCGCTGGTTCACTCCAAATGGGGCCCAAGGACTTGGGCCATCTA
CAGGGAGCTGGATTGAAAGAAGAGCAGCCGGGACTCGAACCGGCGCCCATATGGGATGCC
GGCGCTGCAGGCGGAGGCTTAGCCCACTGCACAGCGCTGTACAGCAGGACCTCCCACGCC
GGTCCAGACTTGGTTTAATGAGATTTCAGTTGGTGACTTTTGTGGTTACTACACGGTTTC
TTCATTAGCTAATGTCTTAAATCGCCTTATTAATAAATTGGGCTTTATCCCATGTGTATC
TAGGAAACACACACACATATCTGGGGTCTGGGATCCACTGGGTGTCCCCTGCAGTCGAGG
GGGGCTGGTGTGTGTCCCACTTGGGCTGTTGGCCTGTGTCCGGTTTCTTGTGGTTCAGCC
AGGCTTTGCAATGATGACTCAAAATAATCTGTCAATCCCCTGAGTCCTGTCACTGATGTC
TCCATGTCTCTGAGCAATGCCTGCGGGGAGGGCTGGGCCACACACGCCCAGGGAGGCGGG
ATCCCTCGGCCCTCACACACCCGGGGAGGCGGGATCCCTCGGCCCTCAGCCACTTAGTGG
GCGCCCTGCTCTTCGTCCTGAGGTGTCGTGCACGAGGACCTCCGCCTGCTGCTGGAGACT
CACCTGCCGTCCAAGAAGAAGAAAGTGCTCTTAGGGGTTGGGGACCCCAAGATTGGTGCC
GCCATACAAGAGGAGCTGGGCTACAGCTGCCAGACTGGAGGCGTGATAGCCGAGATCCTG
CGCGGTGAGGCTTGGCTAGAGCCACGAGGTCGCTCCTGGGAGGGGCCCGGGGTGCCGGAG
CTGGCTCGCTCACGCTCCCGTGTCGGCTGCCCCAGGAGTCCGTCTGCATTTCCATAATCT
GGTGAAGGGGCTGACCGATGTGTCTGCGTGTAAAGCCCAGCTGGGCCTGGGCCACAGCTA
CTCTCGGGCCAAAGTGAAGTTTAACGTGAACCGGGTGGACAACATGATCATCCAGTCCAT
CAGCCTCCTGGACCAGCTGGACAAAGACATCAACACTTTCTCCATGCGCGTCAGGTAACA
GCCAGAGGCCGCCCCTCACCGCGAGCCTCTGCAACGCCGGTCGGGCGAGTGTGGGCTGGG
CCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAGGAGGAGGCAGA
GCAGGCCCTCCCCATGTACACCTCAGCTCTGGCCTCATCGTGCCTGGGCTGTATTGTGAG
TGGGGGGACAAGGCGTTGAGGGGACCGGCATCGGGCTTGTCCCTGTTTGCTCCAGGCCGA
GTTGGGTGGCGAGGGCTGAGGCGGGTGCGTTTGTGGCCTCGCGGCAGCTGAGCCAAAACC
AGGTGGGACTGTGTCTCTGCAGGGAGTGGTACGGCTATCACTTTCCGGAGCTGGTGAAGA
TCATCAATGACAACGCCACGTACTGCCGCCTCGCCCAGTTCATCGGCAACCGAAAGGAGC
TGAACGAGGACAAGCTGGAAAAGCTGGAGGAGCTAACGATGGATGGCGCCAAGGCCAAGG
CCATTCTGGATGCCTCCCGGTCCTCCATGGGTCAGCACAGAGCCTCACAGCTGGTACGGG
GGGAGGGCTCCCAGCAGCTGGCACCTGCACTCACACTGGGGTGTTTCCAGGCATGGACAT
CTCTGCCATCGACTTGATTAACATCGAGAGCTTCTCCAGCCGCGTGGTGTCGTTGTCTGA
GTACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAGGTGGCCCCCAGTCT
GTCGGCTCTCATTGGGGAAGCGGTATGTCACAGGGAACAGGAGGGGTGGGGGTGGTGCTG
AGGGGATGCGTCATCCTGCACTGCTTGCTGCTGGCCACCAGGGGGAGACGGGGAGCAAGT
CCAGCTGGTCTCTGACTTGTTCCTTGAACCTTTCTCCAGGTAGGTGCCCGTCTCATTGCT
CATGCTGGCAGTCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGG
GCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCTGTACTCAGGTGCCGCTTC
TGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTCCCTGACCTGTG
CAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAG
CAAAGGGACCAAGTTTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGCCTCTGGGAGCC
GGGTTGGCATGCATTGGGATACACGATCCAGCCCAGCCTGAGGCTCGCTCTGGAGACTTG
GAAGGGAGGGGAAGAAGGGGGCGGAGCTGCCTTGGCTAATGGGGTAGAGATTGCTGATCT
TAAACTCTCCACCAAATGTTCTCTCAGAGCCCTGAAGACACGGGGTAACACACCCAAATA
CGGACTTATTTTCCACTCCACCTTCATTGGCCGAGCCGCCGCCAAGAACAAAGGCCGCAT
CTCCCGATACCTGGCCAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGGTAT
GGGGGGTGGCAGCCGTGAGGAGGAGGGTCTTGGCCGGGAGGGGGCTGACTACCTTCCCAG
CTTCCACAATGATGGTAATATTTTTCGTCAACAGCAATTCACCTAGTGAGTGTTGATACT
CTGGGTCTGAGTGAAGCTGGGGGTAGAGGGAGGGAGCACTAGGGGTGGGGGAGTTAGACC
CTCAGAGGCTGAAACGCACTTCGTTCAACTGCACACACACAGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGC
GACAAAGCTGATTTAATGAGCATGATCCAGCACAGCCAGAGAAGAGAGAGCCCGGGGCGG
CCCAGATCTGCAGGCCCGCTCACCACCTTCCTGTGGCCAGGCAGAAGCGGCGAGCTGCCG
AGATCACCCGGAAGCTGGAGAAGCAGGAGAAGAAACGCTTGAAGAAGGAGAAGAAGCGCC
TGGCGGCACTCGCGCTGGCGTCTTCAGGGAACAGCAGCAGCGCCCCAGAGGAGTGCGAGG
TCAGTGGGCAGGGCCGCCCCAGGGAAGAACCTAGGCCGCAGGATTTGCCACAGAACAAAG
GATGTGCTGTGCCGAGCCATGGTCTGGAGCCCAGGCCTTTGGACTGCAACATCTAAACTA
CCTCTTGATTCTATAGGAAGGAGATAGGTGCTGAGAGAACTTGCTCAAGAGCCCAGAGAG
CTGGTTGTAGCACACACCCGTCCCTGGGCAAGTGTGCGCTGTCCTCGGCCGCCTCCCAGG
AGTCCTCAAGCCGGGGGTAGTGTAAATTCCTGCTCTTGTTCTCAGGCGTGTGTCCGGAGG
CGGTAGCTTTTCACAGTGGGGCTGGGGGCAGGGAGGTCTCGGCATGCCAGGCCAGATCAC
TCCCGTGGGATCTTCACCCAGTACCCAGCGTGTGCTTCAGGCCCCTCTGGGACTTAGCAC
GGCGGCCCCGTGGTGACCAGCATGGCGGGCTTCACTGTAGGCTCTTAGTGGGCTGATAGA
TGACAGTCTGTGTTCATCTTAATGTCTAATGGGGAGTAAGTAGTGTTGGGGTGGCCTTCC
AAAGGTATACCCACACAAGCAACCACCCCAGAAACCCTGGGCAGCTTTAACTGCCAGTGG
CTCTGCCCTGTGGTGTGCTGGGATTTTAATTGGAGGGGGGGTGCACGTGAGCACCATAGG
CAACAACGCTCTCACACAGACCTCCCCCATCTTGCCTTTTAGGAGACGCAGGAGAAACCC
AAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGCCCCTCAGGAGAACGGGATAGAGGAGCCG
CCTGCCTCTTCCTCCAAACCCAAGAAAAAGAAGTCTTTTTCCAAGGAGGAGCTGGTTAGT
GATCTGGCGGAGACAGGGGGCGGCGGAAGCCCTCCCAAGAGGAAGAAACCCTCTGCCCAG
GAGGAAATGGCGAATGATGTGGAAGAGACAGGCCCCAGGAAGGTCCCCAAGAAAAAGAGG
AAATTGTCCGCCAAGGAGGAAGGGGGCAGCGGCCCTGAGGAGGCCACCCCCAGCAAGAGC
AGTGCCAAGAAAAAAAAAAAGCTCCATAAAGCATCCCAGGAAGACTGACAAGCACGGACA
TTCCCTGCACCTGCGAGGGGTACCCTTTCCCGCCCTGTGTCCTTGCCCCAATAAAAACAT
CACAAAATGCTGACAGACCAATGTTTTATTGAACACCTTGTACAAGCATGATAATGGGAA
GGGCAGGGCCTAGTGGGGCAGGGCAGCAATGACAGCCTCAGTGAAGTCGTGGCAGGTGGC
ATAGCCACCCATGTCAGAGGTTCGAACCTGTGGGTGAGAATCATCATCATCCTGCAGCCT
GGGCCCCACCCCCAGCGGCCCCCCCCACCAACTCAGGTCCCTAAGGAGCCAGCCCCAGGA
CAACCTAGGCTCTGCTCAGAGGTGGGTATGGTCCACTGTCTAGAGGCTCAAGGGCTCTTC
CCTGGTCCACTGCACTGAAGGGATGTATGGTCCTTGTGAGGTTGGGAATAAAGGGCTCTA
GCCCCCATGGGGGTGCAGATGGCCGATGACAGACTTGATGAAGTCGGTTGTGGTGCTGTA
GCCGCCCATGTCTCGAGTCCGCACCTACAACCACCAGCGGCAACAGCCGTGGGGAAGAAG
AGAAGACAGCCCGTGAAGCGGGGTAGGGCAATGTGATGGAGGACATGGAATCCAGGGAGG
GTGACATGTTCAGAGAAGATGCGAGGCAGCCAGGATGGAGGGAGGTGGGCAGGTTTGGAG
GAGCAGGGAGGCCCTGCCCCTCGCCCAAGCCACCGTGCGATCAGTGAGTGCTGCTGCCGA
GGCAGAATGGGCAGGCTGAGCAGGAAGGGGGGGGTGCACATCAGACAGCATGAGGTTGCC
TTGGAGGAAATCGGGACATAGACCAGGTGGGAGGAAAGAAGACAGCAGGGGGATGGAGAC
TCGCCCAGGCCTGGGGAAGGCAAAGCTGGGGCCTCATCCTCCTCGCTTCATCCTGTGATG
CTAAAAACACACCATAAAGACACACCACCAGGCCCAGCCCACAAACGCCCAACCAACATT
GCACAGCCNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 1367..1481, 2422..2583, 2675..2873, 3202..3389, 3470..3621, 3759..3859, 4227..4375, 4602..4723, 4960..4971, 4973..5098, 5802..6167
1001..1081, 1367..1481, 2422..2583, 2675..2873, 3202..3389, 3470..3621, 3759..3859, 4227..4375, 4602..4723, 4960..4971, 4973..5098, 5802..6164
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved