Oryctolagus_cuniculus Locus ENSOCUG00000015919
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000015919
Oryctolagus_cuniculus
ENSOCUG00000015919
scaffold_116592
SNORA70
1909..2043
2752
GTTTCCTTACATTGGACTTTTATGGGAAGGTTGCAACACTGACAGTTATAGAAAGCTGC
TTGGTCTTTCGGACATGACCGCACGTCTGGTGCTGTGTCCATGTGTTATGCGTCAGCTTG
TTCCAGAAGACACAGTTCAGAGGTTGAGCATGTATTTGCCACAAACTCCTCTGTCGTTCT
TTGGCCTTGAGGCAGCACGCAAGAGTGCCTGGTGAGCTCACGCACGAAGCCCACCAAATC
TGGGGTTCTTTTTCCTCCTGCAGTTACCGGTATTGTAAGAACAAGCCGTACCCTAAGTCT
CGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTAGACTCTTTCTGCCTAGGTTGGCAGTGCT
CAGTTGCCCACACACTTACCCATGAGCCTTTTTCAGATGCCAAGATCCGTATCTTTGATC
TGGGCCGGAAGAAGGCAAAAGTGGATGAGTTTCCACTGTGTGGCCACATGGTGTCGGACG
AATATGAGCAGCTCTCTTCTGAAGGTGAGGCATGGTTCAGTGTTAACAGTTGATTACATA
GAAGGCTCCTTTGTTTGCCAAGACACTAACCCCCAACCCTTGAGGTGGGGATGGTAATCT
TACCTCAGCCTATTGGTTCCTTCCCCTTTATAGCCCTGGAGGCTGCCCGTATTTGTGCCA
ACAAATACATGGTAAAAAGCTGTGGCAAAGATGGCTTTCATATCCGAGTGCGGCTCCACC
CCTTCCATGTCATCCGAATCAACAAGATGTTGTCCTGTGCTGGTGCTGACAGGTGAGCTG
GGGCTCTGCGTTTCCCGGCATCTTGCCCTAGTTTAGGACTTCTGTTTGGGGCTTGGTCTG
TCATCAGGGCATAAAGGGGAGTCCATGTACATTTAGGCACTGAAGTGGCTGTGGGAGAAG
TCCGCACAGGGCTGGCAAATGGGCCCCCAGGGACATTCCCTCCCTGGGGTTGTAGCTGGG
CCTACAGTTGGTCAAGCCAGCCACAAAGCCATGTTATGACTTTAGTCTTTGTGTCTGGGC
TGCATGTGCTGGGAGCCACTTCTGATGGCCATAGCTCCTTCTCCATCCTCTTGGAAATGA
CCTCTGCTGTCAGGGAGGTAGCTGGGGAGCCATCAGGTGGGCCCATGGTTCTTTGCAGAG
TTTGACACTAGTTCTTTGGGACCCTGTATGCCCTGCAGCTAATTAAGCCGACCAGCTCCC
TTTCTTCATGGGGGCCTGGTGTGCAATGGCTGCAAACAGCAGCCTCCTTGGTAGTGTATG
CAACCTATTGTTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCCCTGCGCAGTGGAC
ATTCGTGCCTCTGACCTCATGCTGTTCTTAATCTAGGCTGCAGACAGGTATGCGGGGTGC
TTTTGGAAAGCCCCAAGGCACAGTAGCCAGAGTTCACATTGGCCAAGTCATCATGTCCAT
CCGCACCAAGCTGCAGAATAAGGAACATGTGGTTGAGGCCCTACGCAGGGCCAAGTTCAA
GTTCCCTGGCCGCCAGAAGGTAAGCACTGCTGCAGCCTCTCTGTTCCCCTATTCTAACCC
CTGGCCTCAAGACTCAACTCTGTTCTGTCCATGTTCTCAGATCCACATCTCAAAGAAGTG
GGGCTTTACCAAGTTTAACGCGGATGAATTTGAAGACATGGTGGCGGAGAGGCGGCTCAT
CCCGGACGGCTGCGGGGTCAAGTACATCCCCAATCGTGGCCCCCTGGACAAGTGGCGGGC
CCTCCACTCATGAGCCTCACTCTCCTGAGCTCGGTAATCATTGANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1133..1240, 1370..1508, 2093..2255, 2337..2489
1001..1058, 1133..1240, 1370..1508, 2093..2255, 2337..2486
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved