Oryctolagus_cuniculus Locus C6orf48
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus C6orf48
Oryctolagus_cuniculus
C6orf48
scaffold_144521
SNORD48, SNORD52
1359..1420, 2803..2869
4034
AACACAAAAACTTGATGTTTAAGGAGATTGGAATACTAATTGATTTGATCACGGCACGC
TGTACACGTATCAAATTATCACATAATAAGCCCTAAATATGTACAATTACATAAAAAATG
TTTTTTAAAAAAACTGTTTTTATTTGAGAGTTAAGGAGAAGGAGAGACATTAGTCTTCCA
TCTCCTGGTTCACTCCCCAAATGACCGCAACGGCTGCAGCGGGCCCATCCGAAGGCAGGA
GCCTCCTCCAGGTCTCCCACGCAGGTGCAAGGGCCCAAGGGCCATCCTCCACTGCTTTCC
CAGGCCACAGCAGAGAACTGGACAGAAGTGGAGCAGCCGGGTCTCAAACCGGCGTCCGCA
TGGGATGCCGGCGCCCACAGGCGAAGGCTTAGCCCAACACACCACAGCGTCAGCCCCAAT
TTAAAAAATTTTGACGTTAAGATTATTTTCTAAAAAACTCTTACCAAATTTTATATTTCA
ACTATATGCAAATAATTATGCAGCAGTATAATAAAACTATTTGGAATATTTAAAAGATAC
GAAGCTCAATACGCGTAACAGGTCCGCCGGCTCAGCGCGGGAGCCAGTTCCGACTGTGGC
GGCACCCAGCGGATGGGTGCTGCGGCGCGGGTCGGACCCAAGCGAGGACGGCCGATAGCG
GGCGAGGGCGCGCGGGGTCCTCGGCCTCGCGAGCCGCGGCTGGGGGACGCGCCGAACTCT
CGCGAGACCGGCTGCGGGGGACTTTCTTCCGCCTGTCTTCCAAAATTTACAGAAACCTCC
CAGTATTAGCAGCATGCCTCTGCAATGACGTGCAACATACTTTCAAGGCCTTTATTTCCT
GTGTTTTATTCGTATCTGGACAAACTATGGGCAAAATGCTGCACGTGGAGGCAGGCATAT
AAGAAGACAGCCATGCCCATCAGGCCCCCGATCCGCGCCGCCATAAATAGCCCCCGCCTG
GCTCGCCCGTTTCTTTGTGCGGTGGGTGCCGGCTCTGCTGTGTGCTGTTGTTCCGCGATG
GAGGATGGGGCAGGCCGGTGGCCCGCCTCGGCGCAGACTCGCTTGCATAGGTACCGCGGG
GACCTGCTGGGGTTGGGGGCCGCACTCCCGGGCTGAGCAGGATGAACGACTGTTAACAGA
CTAGAGTTTCTGAGGTCTCTGTGACGCCACTGCTTGGAACTGACCCAGCCCGGGTCGCAG
GCGGGAACGCCGGAGTCTCCCCTGGCTCTGCTAATTCCTTGACTTGGTTCCAGGTTCCTG
GTGCGTGCCGGCCGCTCCGCAGCGACGTGATAGCCGGTGAGTGGGTCGCGCGTGCGGTGG
CGAGCTCCGAGTGGCTGGCGGCCTTGTGGGCAGACGAGGGTTGATGATGACCCCAGGTGA
CTCTGAGTGTCTCGCTGACGCCAGCACCGCAGCGCGCTGACGGCCCCTCTACCCCGGGTT
CGGGGAGGTTGATGGCTGGAGGGCTCAAGTTAGTAACCTTTCTCTTATTTCCCTTACTAG
GGGGTGTGAGGCGGCCCCCGGTGTTACCAGTGCGAAAAGGTGAGTGTTGCCTGCGGGAGC
CTTCCTGCTTGCTGACCATCTCGTCCCCACGTTTGTCCTTCGTGGGGGCGCTCTCGGGGT
CTGTTTTTATTTTTTTTTTGAAAGGCAGAGTGACAAGTCTTCTGTCCCTTGCTTAGCTTC
CCCGGGCTGAAGCCAGGAGCCAGGAACCCATCCCCTCCACGGGTGGCAGGAGTTCCAGTA
TTTAGCCGTCTTGTGCTTCCCAGGCGTATAAGCACGGAGCTGGATTGGAAGTGGGACCCT
GGTATGGGAGGCATGCCATACCATGTGTGGGTTAACTCAGTACCCCACAACCCCCGTCCC
AGGTCTGCCCTTTTTTTATTTGAGAGGTAGAGAGAGGTCTTTCATCTGCTGGTTCACTTC
CAAAATGGCCAGAGCTATGCCAATCTGAAGCCAGGTCTCCCATGTGGGTGTGGGGGCCCG
AGGACTCGGGCCGTCTTCTATTGCTTTCCAAGGCCATAGCCGAGAGCTGGATCGGCAGTA
GAGCATCCAGGACTTGAACCAGCATCCATATGAGATGCTGGCTCCAATACCCAGTATTTT
TGTTCACCCCTCAAACCTGTCTGCGTCACCCATTTTTCTGTTGTGAGCCCAAGTGCATAT
GGCGCCTCCCAGTGGCCTTATTTTTTTAGTAAGATTTGTTTATTTGAAAGAGCCGTAGAG
ATCACGCATCTGCTGGTTTACTGTGATGGCCAGGGCTGCGCCAGGCCAAAGCCCTGATCC
AGGAATTGAGTCTTGGATGTCAGCATGGGTGGCAGTGGCACAAGCACTTGGCCCATCTTC
TACTGTCTTCCCAGGCACGTTAGCAAATAGCTGAATCAGAAGCAGAGTGCGCAGGACTTG
AACTGGTGCTCCGATGGATGTTGGCATAAAAAGCAGCTTGACCTGCACCGCAGTGCAAGC
CCCCGTCCCTGGCAGGAACTCCAGTACTTAAACCAGCTTCTGCTTTCCAGGCGCATTAGC
TGGTAGCTGGGTGGGAAGCAGACCATCTGGGGCTCCCGGCACTCTGATGGGGTGTGGGTG
TCCGTTCTGGCTTAATTCACTACTCCACAACCCTGCCCCAGGTCTCCCTGGTTCCTGATG
AGCACATGGTACGGTGCAAGTATTCTGCCTGGTGATTCTCTAAGCACCACTTTTTGGATC
TTACTTCCTGTGCAGCTGTTACTGCTTGTATCCCTGGCTTCCTTATTTGTTAGAGGGTAC
TGTCTCTTCCAGATGGCATCCCTTGATCCAGGTCTCCTAAACAGGGGATGATGATTTCAC
AGACTAGAGTCTCTGACCCTGGTCCTGATGTCAAAAATGAGTTCTGACTCGTTTAGGAGA
CCGGACACGGGGGTTTCTGCAAGGGCTGTGGCTCCTGGTTGGTCTCATGGTTGTCCGGTT
TTCACCTCTCTAGGATGAGAGCTTTGGAGACAGCCAGGGGCGGTGCCCCCTGACAGACCG
CGGAGGCCTCAGTTGTAGCTGGGCTGACTGATGGTTCTGTTCCTGCTGCTTCGTCCCTGG
GCTGTGACGAGTGCGGAGCGGGCCCTCTGAGTGCAGTGGTGAGTGTTGCTGGCTTGGGCT
CCCAGCACAGCACACAGTGGTCGTGATGACTTGGTTGGACTAGAGTCTCTGAGCTTTCTC
TGAGGATCTTTGAGACCACCTGATCCACTCTGTGCTTGTGCTTACCCCAGCACCCTGGGC
GGCATGTCCCCTACTGCTGGCCTGCTGCTCACCGCTGGTTGCCAGCATGGTTCTAACACT
TGTTCCTTTTGTGGACTTTCAGGAGTTTGCTGACAAGGATGGGGCAGACCATAGGAACTC
AGCGTCTTTGGCGTTTTCCTGAGCGACCATCAACAAATGCAAAAATAATAGAAATTTTGA
GGCCCCTGCATGTCAGCTGGAAAGGTTATGACTACTAATTTTGTCAAAAGAATTTCAATA
AAATAAGTAAAACAAGTAATGGATTGGTCTCAGTGCAAACAAGGCGCCATAGCGCTGGCC
CACAAGGCAGTAATTGAGAGAAGTGGGAGGTGGCATCACACCCGGGAACAGTCACCATGG
TTGGCACCAAAGTGTTTCTTTACAGACAGGTGTAAAATAGGATTACCAGAGTACTTTCGT
GTCCAGTATTTTCAGTTTCTGGTTGTGTGAAAACGGGGCCCCTGACAGCTTCCCAGGTGA
CTGTGACAGCAGGAAACTGCAGCCCACTGTGTACCCTGTGTGAGGTGAGACAGCAGCATG
AAAGTGCAAATGGAATTGAAGGACAAGTGCATCTTCAAAATTCTAAGACATTTGAGAGTG
ATCTAATTCACTGGTACACTCACTAATGGCCATAACGATCAGGGTTCAGTCAGACTGAAG
CCAGGAGTCAGGAACCTTGGGTCTCCCTTGAGGGGTGCCAGGGCCTAACTACTTGGACCA
CCTTCCACTATCGGGCATGTTACTGCAGAGCTGGATTGGAGGCAGGACCCTGGAACTGCA
GCTCTATTAGGGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1044..1067, 1070..1133, 1135..1157, 1169..1193, 1196..1200, 1202..1235, 1277..1295, 2953..2955, 2958..2967, 2972..2989, 2993..2995, 2998..3027, 3032..3034
1001..1039, 1044..1067, 1070..1133, 1135..1157, 1169..1193, 1196..1200, 1202..1235, 1277..1295, 2953..2955, 2958..2967, 2972..2989, 2993..2995, 2998..3027, 3032..3034
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved