Oryctolagus_cuniculus Locus ENSOCUG00000010220
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000010220
Oryctolagus_cuniculus
ENSOCUG00000010220
scaffold_211036
SNORA69
2775..2906
4469
GTTGTGGCCATTTGGGAATGGAAGGCCTCTTTCCCTAACTCTTCCTCTCTCTCTCTAAC
TCTGACTTTCAAATAAATAAATGGCTGGCGCTGTGGAGTAGCGGGAAAGCCGCCACCTGC
AGTGCCACCATCACATATGGGCGCAGATTCTAGTCCCCGCTGCTCCTCTTCCGATCCAGC
TCTCTGCTGTAGCCTGGGAAAGCAGTAGACGATGTCCCAAGTGCTTGGGCCCCTGCACCC
ACGTGGGAGACCCAGAAGAAGCTCCTGGCTCCTGGCTTCGGATCGGCGCAGCTCCGGCCG
TTGGGGCCAATTGGGGAGTGAACCATTAGATGGAAGACTCTCTCTTCCTCTCCTTCTCTG
TGTAACTCTGACTTCCAAATAAATAAATAAATCTTAAAACAATAGAAATAAAAATAAAAT
AAATGAGGAAGACGAAAAAGATGACCAGGTCGATATTACTTCCTGCACGCGAGGCTGGGG
AGGCGGGTGGTGGGTGGAGGATAGGCCGCGGGGGAAGGCTAGGTTGCTCCGGGCGGGGCG
TTGCCGGGCCCCTCTAGGCGCGCTTCCTCACAAATCCTGGGCCAAGTCCCTGGCGCTCAG
AGGTGACGGATGCCTTCTCCGCCCTTCTTGGGGGGTAGTCCCGCCCACTCTGCGCCCTCT
GCTTTCGGAAGGGCTTCTACCTTGGCACTTATCGCAGGCAGTCCTGCCTCACCCAAGAAA
CGGGGACCCTGGCACCCTGAAGGACTCATGGGGGAACTCACTTACGGAACTGAAGCAAAG
CCAATTCCATTTCTTAGGAACGAGTACTCATTCCCAGGGCCCCCAGAGAGCGCACGCAGT
AGGGGCGGAGAGGGAAAGGCATTAGTGGGCGGTCACCGACGTATTGCGTCACCTCCTAAG
CCCTGCCCCGCCGTGGCGCCTTCTAAACGCGTTCTTCCGCCGTCTCCTTCCTTTCTCCTT
TCCTCCGCCATCGTGGTGGGTGTCCCTGATTCTTCCTCGCCATGGTAAGTCTATCGGCCG
CCATCGGCCCGAAGATGGTTTTCTGAGAAGCGAGGCCGCCGCGGACATGTCGGGCCTGCA
TGGAGCGTCACGGGGCAGAAGCTCTTTAAAGGCTTTCTTAAGAGAAGGTCGAGTTTGTCA
GCTGCTCTAGTCTGCGGCCTTGCCGGGGAAACCAATGAGAAAACGATTGCTTAGGGATCG
CGGGGTTGCGCTGACGCCTTGCTTTCCCAGGTGCCTGCCGTATCGCCGCCGAGGCAGCGT
CCCTTTGTCGGGACGGAATTGTGATTCTGCGGCAGGAATAGGGGTCGGGTCGGGGGGGGC
TTCCCAGAAACCCTGGCCCCGTTGCGCACTGCCCGAGGCATGCACGACGTTCCTGGCATT
AGGTGTGGAGTCTGGAGTCTTGGTTTTCAGAGAGCTGGGTACCCAGGCGCATAGCACACT
GTTAGGTTACAGGACTTTTTAGCTGATTGTTCGGAAACTAGAAACGTCACCCCGTGGAAG
CGCCTGAACAAAGAGTGTTGTGTTCTGAGCCCATGTTCTTGTTCGTCGTTTGTACATTGT
TAGTGAATGTCAACAGCTGACCGGTTACTGTCCTGTGGCACAGCTTCCTGGGAAGTGACA
TTTTAATTGCCTTCTAGGTTTGAGTTTACTGCTTGATACTGTGGGCTAGATGACATGAAA
GACACGTAAATAGGATTAATATGAAAACAGTAGGTGAGTTAGAATATCCCTGCTCTCCTC
ACAATCACCCTTGAGGAGGTAGGTACCTCTGTCTTAGAAATCGGGGAACTGAGAGTGACT
GGCAGGTGATAGGTGGTCACAGTGTTATTTCAGGAAGCCTCTTTGCTCACCCTAGCAGTT
CAAATTATAATGGTCTGAGTGGTTGACAGCAGGCTGTCCTGGCTATGGAGCAACGAAGTT
CTGGACTTAAATGGCAGCTCTGCGCATTAATACTGGTTTTTGAACAGTGCTACCTGCCTC
CAGAGAAGTTGTGAGGTTCAGAGGGCTTGGTGGAGATGGTTTCAGGTATAAAGCACTTAG
GTGTTTGTTGGAGAAAGAGTTTCTAACTTGGAATCATGTGTGCAGGTGTAGTTTCACTGT
CTAAAATACTTGCATTTCCTTGCAGTCTTCTCACAAGACCTTCAGAATCAAGAGGTTCCT
GGCCAAAAAACAAAAACAAAACCGCCCCATTCCGCAATGGATTCGGATGAAAACTGGTAA
TAAAATCAGGTAAGACCTCCTGTTGTGCTGCTTGGTTTTAATTCAACATAAGGGTACAGT
TTTTAACACTGACATGCAATTGAATGTTACTTGAACCCAATACATCCTGTACCACCATTC
TGAATTTTTTTTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCCCAGTTGGCCGCAAAGGCCGCAGGTGCACCAATCTGAAGCGCAGGAGCTTCTTCCAG
GTCTTCCCACGCAGGTGCAGGGGCCCAAGCACTTAGGCCATCTTCTGCTTTCCCAGGCCA
TAGCAGAGAGCTGGATCAGAAGAGGAGCAGCTGGGACTAGAACCGGCGCCCATATGGGAT
GAAAGAAATGTATTGAAAGCAGGTTGCAATTACAGTGCTTTATTTTGTGAAAGTACTGTC
ATTATCCTGCTGAAAGAAAAGCTGTGTTGGTCCTTTTTGATTTTGCCACTGTGCTGGTAA
AATCATGACAGACTGACATCGACAATTCTGAATTGTTTTAGCTTTGCAAATCACTGTTGC
TGCAGTAGACATGAATGGGGTGTTACTGTTAAAGTAGGTAAGGGGTACATGGAGTAGGGG
AGTTTTCTCACTATTTCAGTGCTGATTAGGATCCTAGTCTTCAATCATTTTCAGAAAATA
AAAGTTTGGCAGGTCATCTTTAAAAAAAAAATTGAAAGTTAGATCTTCCAGCCTCTGGCT
CACTCCCCAGATGGCTGCAATGACTGGAGCACAACTGATCTGAAGCAGAGCTTCTTCCAG
GTCTCCCATGTGGGTGTAGGGACCCAGGGACTTGGGCCATCTTCTACTGATTGCCTAGGC
CACAGCAGAGAGCCGGATCGGATTGCAGTGCTGGCACTGCAGGCAGTGGCTTTACCCACT
ACACCACAGTGCTGGCCCCCTAGATCATCATCTTACTCTCCAGAAAAACCACCAAATATG
TTAAATAGGAACACCTAAACTGGTCATGCTGTTTGTAACTTGAAAATTTTTTTCTGTGTA
GGTATAACTCCAAGAGGAGACATTGGAGAAGAACCAAGCTGGGTCTATAAGGAATTGCAC
TTGAATGGCGTGCTCATTTCTTCTGTCTCAATGTCACAACGTCACTATCACCACATGAAG
CTGAAGATGTCACCATCATCTGGACAGCTGGACATGTTTGATTAGGGCTGTGACCAGTGG
GCTGGTTCAGTAATAAATATGTGATCCCTTTTGAACTGCTGTTGTATTCTGGTTTGTGAA
GTGCCTAGCTGCCTCTTAACGGTCCTGTAGAACATTCTGCAATGATAGAAATGTTCTCTG
GCTCCAAGTACCTGACGTGTTTAGTGTGAAGGATTGGGGGCGGGTATTGAATTGCAGTTA
GATTTTTGTAGGCAGGAATTTTCTAAGCTAGAAGTTGGCAGAGCAATCTGTTGCCTGTTT
GTATATGACCTGGTCACCTATTTATTTACATCCCTATTATCTATGACTGTTTTTAACCCT
GATGCACAGATGCTGTGTGGCCTGCAATACCTCAAATATTTGTTACTTGGCTCATTTCAG
AAAAAGCCAACCCCCTGATCCTGAATTCAGTATAGTTCACTTTTGGCCTTAAAGATTGAG
GTGGTCTGTGGCGTTGTGGGCTGTGTGGGCTGTGGGATGCCTGTGGTTGCACAGCAGGAG
CACCTAGGGTTTAAATCCCAGTTTCTGCTTTCCAGCTTCCTAGTGCACACCCATGGCACG
CAGTAGGGTGGTGACTAAAGTGCTTAAGGTCCCCTACCAGCCAAATGGGACACCTGGATT
GAGTTCTTGGCTCTTGCCATTTGGGGGACTAAACCGTTGGATGGGAAATGGCTATCTTTT
TTAAGAACAGATGGAGATTAATTGTTGGCATTGTAGCAATTGGTTAATGGCAACACTGAC
TACCAAACACCTGCATCTGGGTTAATGAGCATGTTAGAAAAAAATGCATTAGAGTAATTT
TTTTTTTTTTTTTTACTTTAAAGAGTTAGGTCTTACATCCACTGGTTCACTCCCCAATTG
GCCACAATGGTTGGAGCTGCGGAGATAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2125..2228, 3421..3469
1001..1003, 2125..2228, 3421..3466
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved