Oryctolagus_cuniculus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus PABPC4
Oryctolagus_cuniculus
PABPC4
scaffold_200324
SNORA26, SNORA55
6495..6613, 9516..9650
15816
CCTCGGGCCCCCGGGCCGAGTGGGCGGGCACGACTGCGCCCAGGTCGCGAGGCGCCCTT
CGACCAGCAGCGCCCGGGGCGGGCGGGTATAAATGGAGCGGTGGCTCCCCCGGCCGCCTC
TCTCCGCCCCGGGTCGCCGCTGCCTCCGCCGCTTTCGGGCTCAGCAGCCTGAAGAAGAAA
AAGAGAAAAAGATAAAAAAAAACCCGAAAACGCTTTAAAATCTTTAAAAAAAAAAAAAGA
AAAGGAAAAGGACAAGAAAAGGCGAATCCTCCTCGGAGAACCCGCGGGGAAGTCACTTTT
GCGCGCTTCCGGCCTGCCCCTCGCCGCCGCCGCCGTGCTTTGGCGTCCGTCGGTCCCGGT
CCGTCGGCCCGGTGGTGAGCGCCCGCCCGCATGCAGCTGCCTGCACGCCGGGCCGCCGCC
CGCGCGCGTGGCAGTCCCCGGCCCCCCGCGCCCTCGCCCCCCGCGCGCCGGCAGAGGCGA
CCACCACGTGTCCGCGCTGCCCTTCGCCGTCCCGCCCGCCCGAGGCTTGCCGAGTCGGCA
CCCGCAACGATTTGGTTTCCCTCTGCCTGGCTGCTGTAATCTTAAACCGCCGGGAGCCCG
GGGCCTGTATTTATAGAGAAACGCGTGTCCCCGGGCCGCCGTGGGCAGCATCTGGTTCCC
TGCTGGAGAAATTTTTTTTTCCCCCTTCGGAAAGGGGTTTCCCGTTTTAATTTTTTTGTG
CTTGGTTAATTTGGAGCTTCAAACCGGGACAGCTGAAAATTAACAAACTCCCGACGAGGG
CCATATTGTTTTTGAGCGCCTTTTGTCTGAGGTTTGGCCAGCCCCGAACTCCCGTTTGCG
TCCTGTCTCTGAGCCTCCGGACTCCGGCCTCTCCCGGCTGCGCCCCGTGCCACCTGTGAG
CCGCGGCGCGGGCCAAGGCTCCGAGAGGAGCCCCTTTTGTTCTGCAGTGGGTCCCCTAAG
ACGTCCTCCTGGCGGGGCTCGGGGTGGTGGGGGGTGGGGAGATGAACGCTGCGGCCAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGTGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTACGAAAAGTTCAGTCCTGCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGGCGCTCCCTGGGTTATGCCTACGTCAACTTCCAGCAGCCAGCTGACGGTGAGT
AGAAGCCATGCCCACTCGCTCCTGGAATCCCAGGAGACCCTGGGAGTCTCTTCTCGGCAG
GGCTGTGTGGCCAGGGAGGGCGGCGTCCCGACAGCAGGTGGCTACAGAAGCAGTAGTGGG
GAGGCAGGGTGCGGGCCCGGACAAGGCAGGGCGTGTTGTCATGACCCCAGATGCAGTCTT
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCATACCTCTGCAG
GCCCTGTCCCTGCTATAAATAAGTGCAGCCAGATTTGTCGGGGTAAGCCAACTTGCCTGT
GCGGTGCTGTCTGGAAATAGCTGTGTTGAAGTGGACTCCTTTTGCTAATTAGTGGCAGGG
TTTGGGGTCCCGGGCTGTGTATCCTGCTGTGCTAAGTGCGCTCCTGGATCTGCCTGGTCT
TCTCCCCTTTCCCTGGCTCTTCTCTCTGCAGACAAACCCACCTGAGAACAGTAGGGAAGG
TTGGCTGACTGACGGTTGAACTTGTGGGGAGTCAGCCTTAGGCAGTGTTGTTCCCCTGTG
TAGTGAGTGGATCCCCCATGAAGGAGGTTCTTGGTGAGGTCGCTGCACCAGTGACCTCAG
TACCTGTGCGGCAATGATGCCCAGAGAAGTGGCCACCGGATCTGGGCATCCTTGTTGCCT
CAGTGACGTTCCAGGCTGACAGGTGATAATATTTTGACTTCTGGTTCTTTAAATGGGCTC
TTGGTTACACCTGTACACACTTCATGGGGAAACCAAGGAAGCATCCTACGTACTGGAGGA
GGAACTTGGTTGGGCACCAGGGTGGTTGAAGTCCCAGAATTCTGTAGAAATCAGGTGAAA
GCTTGGAAAGCCCAGCCCTGGGGACAGGAGCCGCCTGCGCTGCGCTGTGCTGTCTGCTTA
GCGGAAAGGTGTGGTGGCTGCCTCCTTGTCCTGATAAGGCAGAGAACATTGCCTGCTGGG
TGTTGCCAGTTATATCAGCCTGGTGATTGAGGCTTTTTTGTCTAAATAAACTTGGGTTCA
GGACACTGGGCTAGCTTCAGGGATAGCACATTCTTTGAAATCAGTTGCTCATAGGTTTTA
TCATTTGTCTGTAGATAGAAGACTGCAGACCAAAGCTAGGTGATAACTTTGCTGTTCTCA
CTAGCTAGCTGCACAGCTTAGCCACCCCATTCCCAAGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCCGGGTCACAGTGGGGGGCATTAATCTCACGTGAGAAGTAT
TGTCATTGGATCTTGGTGCCAGTGGACCTTCAGGTTGTCTTTACCTGACAAGGACGGTCC
CAGAGGGGTCGGATTCTCAGTGCGGCTAGAGGAGTGTGATTCCCTTTGGTTCTCGAAACG
GTGGTGGTCACCTCCCCAAGGGCTGAGGCTTTATGTCCTTGATTGAAATGTTTCTCTCCC
AACAGCTGAGCGGGCCTTGGACACCATGAACTTTGATGTGATTAAGGGGAAGCCAATCCG
TATCATGTGGTCTCAGAGGGATCCCTCTTTGAGAAAATCTGGTGTGGGAAATGTCTTCAT
CAAGAACCTGGACAAATCTATAGATAACAAGGCACTTTATGATACGTTTTCTGCTTTTGG
AAACATTCTGTCCTGCAAGGTAAATGCTGAGTAAATGATTTTAGCAGAATAGTTACCGAA
CCTTGAAAACATGAGAAATACCAAGTTGGAACTGCCTTGTTGTTGGGGGCAGCAGGGTGT
GGTGACTTTCAGAGTGCTGGGAATGGAGTCCTGCGGGTCCCAGCGGAAGCAGCAGGTGCT
TGCATGTCTTGTTTGGCTTCCCTCTCCTGAAATACCCTCCCTGTTTCCCAGCTTTGGAAG
CCTCAATAGAGCAGAGGCTGGCAGGGGAGGGGCTGAGAAGCACCTCTGGTCTCTAGGAAG
CTTTACTTAGCACTCTGCCTCACAGATCATAAAATAGATTTTTAAAAATTTGATATTCTG
TTCACCCTCTTTTCCACACATTGTTTATGTGATATAGACACTTCATGGAACTTCCATGAT
GATTGTTCCTGTGTCTCATACCACATTGGATTAAAGTTCCATGTGGCCTCGAGCAGTGGT
TTGTCTGTGTTTGCACCCAGAGCTCTTAGAGGATTTTGTGATACAAATGAGTAAGACATC
ATGTGGAATTTAAGCAGCATGATTTGTACATGGAGCATTTACGAGGTGTGTGGTGATGTG
CCGCGTTGTTGGAAGATTCACACTAGCGTAGACATTGTGGTGCGGTGGGCTAGGCTGTGC
ATTTGGCTCTCCTGTACTGCATTCCGTATCGGAGTACTAGTTTGCATCTCAGCACCTTCG
TTTCTAATCCAGCTTCCCGCTAATGCATTCTGGGAGGCAGCATTGAGGGCTCTCTGCCAC
TTACCAGGGAGACAAGGATGGAGCTGAGGCTCCTGGCTTTGGCCTGCCCAGCCCTAGCAG
TTAATGGGCATTTGGGGAGTAAACCAGTGAAAGATAACCTTTCACATCTGTAAAAATAAT
ACACTTTAAAAAAATACCAAGTATGGTCGGTGGTGCTAAACGATCTGCCTTGTCCTTGCC
AGGTGGTGTGTGATGAGAACGGCTCTAAGGGTTATGCCTTTGTCCACTTCGAGACGCAAG
AGGCTGCCGACAAGGCCATCGAGAAGATGAATGGCATGCTCCTCAATGACCGCAAAGTGT
GAGTGTCCCAGTCCGGAGCAACAGCCATCGCATGAGCCAGCCGTTGGCCCCACCTCGGTA
TTAACTGGCACACACAAGGCGGCTACTGGTTCTCTCGGCCCAAGTGTGGCCTGCTCCTAC
CTCTCCACTCCAGGGCTGGTGAGTCTTCCTGCCTGAGCTGTGGCAGCCCTTTTGACTCGC
CGAGGTGGGCTTTCCTGCCCAAGCCGTGGCCTGCCTGCCGCCTCCCTTACAGGCATCCAT
CCGTGGGTTTTGTGAGCATCAGCAGCAGGGATGGCGGGAAGGCAGCTCTGAGCCCACTCT
GAGCAGGGGTCTTGGCCAGCAGCAGAGTGGAGAGGGCCCTGGGCTGACCAGGAGCTGTGT
ACTAGCTATGTGACCTTGGCCTTCCTGTGACTCAGGTCTGTCCATGGGTCTCGCTAGTGG
TTGATTCCAAATTGTCCCTCTAGTTCTCTGTTTTCTATCGTGACTCAGTGACGTCTAAAA
CAAGGCTGGCTCCACTGGAATACTTAATTTGATTATAATGGAAACAGTCCCATCCCTTTG
CTTGCAGACACATGTCATAACAGACCTTGTCACTTGTTAAAGTGCACACAGAGAGTGGGA
ACTTAGAAAACCACGTTGAGGAAGGGACAGTGCAAGCTGAAATCATTTCTGTTCTTCGTG
GTGTTGGGCAGAAAAGAGAAGATGGGTTGTGTTTCAGATGTTTCTGTGCACAGCGGTCAG
TTACATGTAGGAAAAAAAAAAATTTTCCTGAACCAAAATGAATCAAATAGCCGAGCAAAG
GGTACCTCTTTGCTAGTACTAACCACTGTTAACAGTTTGGTTTGTATCCTTCCAGACCTT
TTCTATGCATTTACTCTAGTAGAGCGCGCGAAAGGAACGTTTTAAAAACATGGGCATCAG
GTTACGGGACGAAGGCAGTGTGAGGGGGTAGGAGTAGCCCTGGTCTGGGCCGGGAGCCCT
GGGGCTGGTCCTCGCAGGAGTAGTCCTGCCTCTTTCTCATTCTGCTGGGGACTTGTCTCT
GAGCTTATTCTTGGTGGTGGATGGGGACCTTATTTATTTTAACCTCTCCTGTCGGCCTTT
AACTCGCATTCCTTTGGAACCCCTGGAAATCACGTTTTGTTCCTCTGGGTAATGACTGCT
TTTCATGGTCTCTTTTTAGGTTTGTGGGCAGATTCAAGTCACGTAAAGAGCGGGAAGCTG
AGCTTGGAGCCAAAGCCAAGGAATTCACTAATGTTTATATTAAAAACTTTGGGGAGGAGG
TGGATGATGAAAGTCTGAAAGACCTATTTAGTCAATTTGGTAAGTTGAGAGTCCTTTGCC
CTATTTGTCCCCTTTCACAGTCTACTAGACCCCAGAACTCATCTATTTTTACTTAAGAGA
TGAGGACAGTAAACCCAGAAATAAAACAGCTTGCATGACCAAGGTCACAGGGTAGGTGGG
GTAGACCTCTTCCTACCCCTAAGGCCACCTCAGCTGCTTAGTCCCAATTAGACGACCAGG
CGTACACCCTTTCCTGTGCCCTTTTAAAACTGACAGTGCTTTAAGAGGCTAACACAGAAG
GGGAAAGTAAGTCTCCCTAAAACCCAGAGAAGAGATTGTCATCTCCTCTTTGGATCCTGT
CTGGAGATACAGCTGATAAGAGAAGACCAAGGCATAGTGTCTTTCTGTCTTAAGAGTTCA
TTTGGGCTGGCCAGAGATTTACGTTGAGAATTCCTATAGAGAAGCCTTTTCTCTAGCTAC
GGTAGAGATGATGTTACTAATAGTTCTGTGCTTTAATAGGTAAAACCCTCAGTGTCAAGG
TGATGAGAGATCCCAGTGGGAAATCCAAAGGCTTTGGCTTTGTGAGTTACGAAAAACACG
AGGATGCCAACAAGGTGAGAGTACCACAAGGACGGGGAGAATTTTGTAGGAGGTGGTCCC
AGAGTAAGGGTAGGGTCTTGCTAGCAGGTGGTAGAGCAGAGCTAGAATGGTCTGAGGGTC
TGGTAATAAATAGGTCCTAAATTTGTCATTGATCGTTTACAGAGCACTTGGCACGTACCT
GTTAGCCTGTTGTTGAAAGAACAGGATGGTTGTTCCCATTCATGGGTGAGGTGACCAAAG
CCCAGAGAGTTGCTGATTGATGACAGCACACTGTAGGCAAAGTATGGTGCTCAGCCCCAA
AAAACACATCAGAGAGCGTGAGAAATTTAATGACAGCCATGCCCATCATGTTTGTATTTA
ATGAAAAACCTGGGTTTTCTCGTTTCCTTTTATATTATCTGGACCAATATCCATTTAAAT
ATTAATTCCACTTTAGAGGTGAGGAAGTGTGAGCTTGTTTAGCAGACTTCAGAGATGGCA
TAAAATTTGATTTTAACCCACAGGAAAGAGGTTTTTCTCAGTGTTGAACTGGACTTAAAT
AGACCTCAAATAAGGCCCCTGTCTCTGCAACTTTATTTTTTCTCTAGGCCGTAGAAGAGA
TGAATGGAAAAGAGATTGGTGGGAAAGTCATATTTGTAGGCCGCGCACAGAAGAAAGTAG
AACGGCAAGCTGAATTAAAACGGAAATTTGAGCAGCTAAAACAGGAGCGAATTAGTCGAT
ACCAGGTGAGGTGGTCTTGGCCCAGCCTGCCAGTGGGATATACTGTGAAACCTATGCATA
GCACCCTTTGTTCACCCAAGACTGCCTCCTCTCAGTTCTTCCAGCACCAGGTTTAGAAGG
ATAAGTCACTGATGAGATACTATAGTGATTATAGAACAGAGATTCCTTTGGAGGGCCAAC
TTTCCTAGAAAACTTGGCATGTTGGACTTTGCTATGTGGGTTCCTTCTATTTAAGATAAA
ACCTGGTGAGAAGAGCCCTACAGCGGTGAGTGGCCAGCCAGAGCAGCTGTGAAGCAGATG
CCTGGTTACCTTGGGGTGGGTGTGAGTTGGATGGAGCAAATAACACTGTTTGGGACACCT
GCATCCTGTATCTCAGTGCCTGGGTTCAAGTCTTGTGTCCACTCCTGACCAGCATTCCAG
TTCCATTTAATGCATATCCTAGGAGTCAGTGGATAATACCTCTGTAGTTGGTCCCAGGGC
TGGCGTTGTGGTATGGCAGGTTAAGCCACTGCTTGCAGTGCTGACATACCAAATCAGATT
GCTCATTCACGGATCCCCTGTTCCGTTTCTGATCCAGCTTCTTGCTGTTGTACCTGTAAA
GGCATAGATGGTAGCCAAATTACTTGGGCCCCTGCTACCCAAGTGGAAGACTGGGAAGGA
GTTCCTGGCTCCTGGCTCCTGGCTCCTGGCTCCAGGGGAGTGAACAAAGATGGGAAGACT
CTGTCTCTGTGATTGCCTTGATGATCTGAACTGTTAGGGCAGTAATTTCTAACATTGGGA
TTGCAGGAGAATCACTTGCAGAGCTGACACAATGCTGGGCCCTAGCCCCAGAATTGCTCT
TATATCAGATCTGAGGTCCAAAGATTTATTTTGTTAGTTTGAAAGGCAGGAGTTGTAGAG
AAGGATCTTCCATCTGTTCTCCCACATGGGTAGCAGGGCCTCAAGTACTTGGGCCATCCT
CTGTTGCATCCCTAGGCACATCAGCAGGGAGCTGTATTGGACGCAGAGCATGTGGGGCCT
GAACCAGCACTCTGATGTGGGATGTGGGCATCGCAGGCAGCAGCCCAACCTCTGTGCCAA
AATACTGGCCTCAAGATTTTTATTTCTACAAATTTCCAAGGATGTTGACAGGCTGCTTTA
GGGATTTCACTTTGGGGACCATTGTCTTGGGAAATAGATGCGACATTCAGTTAACAGGGA
TGTTTCTCCTTTATTTAGGGTGTGAACCTCTACATTAAGAACTTGGATGACACCATTGAT
GATGAGAAATTACGGAAAGAATTTTCTCCTTTTGGGTCAATCACCAGTGCTAAGGTATTT
TAATTATATTGGGGGAGTGAAATAGCAGTATTCTGTTACAGATTTTGGCTGTGTTTTACC
TAAGGGTCTAAACTTGTAAAAAGTAGCTGCTAGAGCTCATGACGAGCCTCGGGTGATCAC
TGACATCATAAATAAGAGTGTCAGTTGTTAAATCAACAACAGGAGTCACTGTGCACTTGC
TCCCCATGTAGGATCTCTGTCCTTAATGTGTTGTACTATGAGAATTAACGGTAAAAATAG
TCTTCAAACAGTACTTTATACTTTGTGTGTCCGGGTGATAACTGTTGAAATCTTACTTAG
TATAGAGTTGATCTTCTGTATATAAAGATAATTAAAAATGAATCTTAATGAAGAATGGAA
TAGGAGAAAGAGTAGGAGATGGAATGGTTTGTGGGTGGGAGGGAGGTTATGAATGAAGAA
CCGCTAAAATCCAAAAGTTGTGCTTATGAAATTTATATTTATTAAATAAAAGCTTTCTAT
TAAAAAGTAGCTGCTAGGTTATTCTAGAAAATTCCTCTTTGCTCTCAGTTCTCCTGAGTT
CTTCCTGGGGAATGACATCTCTGGGCTCGTGTTAGGACCTCCTGAGCGCTGGAGTAAGGG
CAGATGAGACCGCGCCCCTCCCTGCCAGCCCTCATAGCACCTGAGTCTTTCCCATTCCCT
GCTGCTCTGTGCTGGTGTGGGGACGGATGGTGCCACAGCGTGGGCAGAGGAAATCCAGAC
GGGCTGTTTTCCATTCACCTTGGAGCCTGTCTCTACAGCTCTGCTACATTTTCTCCTTCT
GGAGAATGAACGTGTTAAAGATTTTGGAGCTGAAGTTGGCAACTTCTTGCTCGGTCTTTG
GTAGGAAAAGGAAAAAGGAGTGGAGAGTTTGCTTTTCTACGTTTTGCTCTTTGCATCATT
TGTTTTCTAAAGAATTTGAGTCTGTGAGCAAGCAAATGCTACAGGGGGACTATATTGCAT
GTCCTTGACACTTCCGGAGTATGATGGAGACTGATGGCATTGGAAAGTTTTGGGTCATAC
TCTGGAGACACTGGCCTGCTTGGCAGAGGTGCAGCAGATGCCACCGAGTCCTTTAGGTGA
TGAGAAAGGAGGCTAGGTGTGCTGGTAAGGGCTTGGTGGCCTGTCCCAGCCTGTGAATGA
TGTGCAAAAGAACTCTGAGTTGTAGGAAGTTAACGCGACGCTAATTCCCTGGGGCTTGTT
CCTTACCCCTTGCTCACCCAGCTGTTCCCATCAGTCTAAGGAATGATAGTGCTTATCTAC
ATAGTAGGCAAGTTTGCCTTTGTGCAAGCAGCAGCAGAACTATACCTTGCAGTTTTCGCA
CATCCTGCTAGCCTGCCTCCCTGGGAGAGTGTTGGGTTGGTGCAAAGCTTTACCTCCATA
GCCTCCATTTCAGGAGGCTCTCTGGGCCCTACACAGAGACACTCACAGTACAAAGCACAC
GCAGTCTGAGGAAAAGCCATACGTACTCTTTGAGGTGGAGAAAAATGCTGTTAGTGAATG
ACTTCATCTGGAAAAAGATTGCCTGGTCTAGTGGACACGTGGCTTTGAAGCTGTTTGTCT
AGGAGAATGTGAAAATGCAGCTCAGGGCCAGGTACCTAGAGTTAGAGCCCAGGCTGCCTG
TCTCCCAGCTTGTCATCCCTGCCGTTCTCACTGCACTCATAGTGGCTGTCATTGGAGACC
TGAGGGTTCTGTGACTGCTGCTCACGGGTGGTATTTCAAAAGCATCATCCTAACTGTGCC
AAGCCTGTTGTCCACCAGGGTCTTGGAAAGGATGAGTTCTACAGAGTTTGTTCCTCATTA
CTGATGTCTTGTGATCTGTGCTTGTGGTGGCTATGATTCTAGGTGTCAGGAAACATCTTT
ATATTCCTGGTTTTATCATTAGTTGTATCACAGTGTTGGGGAACTCTAGCAGTCCCTGTG
GACTTGAAAATGTCTAGGAACCCTAGAGGCTGTGATGATCTCAGGTTTTTGGGGGTTCTG
TTTTTTTGTTCTTTGGGATAGCTTCCTCCCAACCCCAAAACCTTTTTCTTAAGAGGCTGG
TCTCATTTTGTAGGTGATGCTGGAGGATGGAAGAAGCAAAGGATTTGGCTTTGTCTGCTT
CTCATCTCCTGAAGAGGCAACCAAAGCAGTCACTGAGATGAACGGACGCATTGTGGGCTC
CAAGCCACTGTACGTTGCCCTAGCCCAGAGGAAGGAAGAGAGAAAGGCCCACCTGACCAA
CCAGTATATGCAGCGGGTGGCTGGAATGAGAGCACTCCCTGCCAACGCCATCTTAAATCA
GTTCCAGCCTGCAGCTGGTGGCTACTTTGTGCCAGCAGTTCCACAGGTGGGTCTGTTGTC
AGTTCATGTCTTTGGAGTCTGCCCAGTAACAGCAGTTCTGCCCTGACTGGGGAGAGGGAT
GTGGGGTAGTGGAATTCTAGACTGTCAGAGTAAAGACCCTTTAAGGGAAAATGAGGAAGG
ACTTACTTATATCCGTGTACACAGTGGCAGAGTGAACAGTCCCCATTAACCGAAAATGAG
GAAGGACTTACTTATATCCGTATACACAGTGGCGGTGTGAACAGTCCCCATTAACCGACC
CCTCAGCTTCTGAGTAGAGCTCCCTTTACTCCAGACAGTTACCCTAGGGCCAGGTGGTGG
TAAAATGAGTGGATTCAGGTCCTTGAGATAAAAGGGCTTGAGTGCTCTTCTTTCTTACAG
GCTCAGGGAAGACCTCCTTATTACACCCCTAACCAGTTAGCACAGATGAGGCCTAATCCA
CGCTGGCAGCAAGGTGGGAGACCTCAAGGTAGGTGGTGGGGAGAAGCGATTTGATTACCC
AGGCTGCACCTGTCCTAGTCTGCTTGTCTTTCCTGCCTGCCCCTCTGAGGTGTGTCCTAG
GATGTGGTCCATGTTGCTTGCCAGCGATAGACAGTTTTTGTGTTTTCTCCAGGCTTCCAA
GGAATGCCAAGTGCTATTCGCCAGGCTGGGCCTCGTCCAACTCTTCGCCATCTGGCTCCA
ACTGGTAATGCTCCGGCCTCTCGTGGCCTCCCTACTACCACTCAGAGAGTCGGTGAGCAC
ACTGGCCTTTAGGAGTGTGGCCCGGGAGGAGGGTTAGGATGAGCAGGCTCTGGTCAGCGT
TGGGCTCAAGTATTTTGAGTCCTGGTTCTGTAATCCTAGCTGTGTGCTTTAGTAGGTACT
TTAGTCAGGAATGGGGAAACAGTGAGTTCTAGGTGTGCTGGTTTCTTTTAACATGCTTTG
CTCATCTGTGTGACAAAGGCTAACTGTAGAAATTTGCTAGCCAGATGACTACAAAGGTAG
CCTGTTCTTGTGGGTAGAGTGGGGAATGCAAGGAAACTTTTTTACAGAGTTTGTCCTGTA
TTCCAAGATGTGGAATGCCGAGAGTTGTGTTACCTTTGGCTCTTCCTAGTAGCGGTAGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGC
TGGTGCCGCCCAGCAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGATGCAC
ACAGAAGGGGGAAAGATGGGATTTGACGGGTCTGTGCCCAGACTGATGGGCTTTAATTGT
ATTCGTTCCTTCCCTAAGGTGTTCCTACAGCTGTGCAGAATCTAGCACCCCGCGCTGCTG
TTGCTGCTGCTGCCCCTCGGGCTGTTGCTCCATATAAATATGCGTCCAGTGTCCGCAGCC
CTCACCCTGCCATACAGCCTTTGCAGGTGAGGTCCCAGGCAGTTTGCCAAAAGGCTTTTC
CTCATAACCAATTGCTGTAGAAGGTGACTTGACTTTTTTTTTTTTTTTTTTTTTTTTTAA
GATTTATTTATATATTTGAAAGGCAGAGTTACAGAAAAGGGGAGGGAAAGACAATCTTCC
ATCTGCTGGTTCACTCCTCATATGGCTGCAAGGGCAGCGGCTGGGCCAGGCCAAAAAGCC
AGGTTTTTCTTCTGGGTCCCCCATGTGGGTGCAGGGTCCCAAGCAATTGGGCCATCCTCT
GCTGCTTTCCCAGGCACATTATTAGGGAACTGGATGGGGGAAATGCAGCAGCTGGGATAG
GAACCAGTGCCTATATGGGATGTCATCCTTGCAGGTGGCCACTTAACTTACTACATCACA
CCAGCAGCCTCTTTGATTCTTAAAACGGGCATTAAATGTCTGTTCTGCATTAGGGCATCG
TGGTCTGTGTCCTTGCCTTCAGGCTGACCAGTTGGAGAGCAGGGGCTGGAAAGGGTTCTA
ATGCGAGTTAACTACGGAATGCCCCTGAAGGGACAGCCGGTGCTTCCTGTTTTTGTGGAA
TCCACAATCTCACTTAACTCTGACCATCCAGGTCACTTTAACATCTGGTGACGTGTTTGA
TCTTTGGCTGTTAGGCAAGATGACTGGGGGACATGAAGGCAGGAAGAGGTGGAACCAGAG
TTTAGAACTTTGTGTGCTGTCACCAGAGCTGTGCTCTTAAAGGCGAACCAAGAAGCAGTG
AGTTTGTCGTAGAGCTCAGTAGCAGTGCTGTGGTAGTGCCACTCTGCTCAGCCTTCAGGT
CTGTGAGCTGGGAGAAGGCTCCTGAGCCACCTCTGTGCCCTTGCTCTCCAGGGTGGGGAG
TTTCCAGAACTTGATGCTGTGTGGAGAGATGTTCTGCCTACAAAGTCCTCTTTTAGGGCT
GTGGCTGACGTTGGCATTCGTGTTGGCTGTCCTTAGCAGTGAAGGTGATGTGGAAGGGTG
ATATTTGCACCCTTTGACTCCATCTGTATTGGAGGTCACCCTAAAGAAAAGCTGATTCTC
AGGTAGTTCACACACATAAAATGTTTGCTGTAGCCTTTAATATAACAAGACTTGGAATTT
AAGTAACTTAGGGCAAATTAAATGAAAATGTCAGAAAATACTGACCTGGCTTTGTAGGTT
TGGTATATTTATTGCACTTTTCCTACTGATAGCATGCTATTTTCGTTAGTTTTGGTTTGT
GTACTTTCCCTCACCGTATCATTTAATCCCACGAGGACTGAAACCAGTTTGAGAGGACAG
ATGCTTCTGTCTCCTCTTTGACATGCTTAAGATATTCACATGTCGACAGTTCAGATGTGG
CCACCAGCAAATGTCCTGTCCTTGATGCTAACCACTGCCTCTCCTGGTTCCCAGGCACCC
CAGCCTGCTGTCCACGTGCAGGGGCAAGAGCCCCTGACTGCCTCCATGCTGGCTGCAGCA
CCCCCCCAGGAACAGAAACAGATGCTGGGTGAGTGCCCATGTGCCTGCAGAAGAGGGTGG
CTGACCCAGACAGCAGTGTCCTCTCTACTGGGAAGCGATTTGGTTCTTCATGAGCTGTCC
CACCCACAGGAGAACGATTGTTCCCGCTCATCCAAACGATGCACTCAAACCTGGCGGGCA
AGATCACGGGAATGCTGCTGGAGATCGACAACTCGGAGCTGCTGCACATGCTGGAGTCCC
CCGAGTCTCTCCGCTCCAAGGTGAGTGGTCCTCAGACCCCACAGCTTCAGCTCCCAGCTA
GATCACAGTGCCCTTGGACGCTCAGGTGCAGCCGGGGGTGGGGGGTGGGGTTGTCCTCCT
GCCTTGCCTGTGATGGGGAAAGCATCCAGCACCAGAAATCCAAGGGCTATTTCCACACTG
GGCTGTGTTCCACCCCTGGGCTCAGACACTGGGGAGGGGTGACATGGCTCTCCTCAGCCT
CACTGACCACCTGGAGGTTTCTCACAGGTGGATGAAGCTGTGGCAGTTTTACAAGCTCAT
CATGCCAAGAAAGAAGCTGCCCAGAAGGTGGGCGCTGTTGCTGCTGCTACCTCTTAGACA
TGGAAAAACCGTATGTTGGCTATTTCATTTTTCCGCAGTGGTTTTTGGTTTTGAACGTCT
TACTAAAAGAAGAGGGGCAGTATATAGAACGCCATTTCTGTCACCCAGCCTGATAACTTG
TGCAGGTCATTGCTGAGCCTTTTCTGTTATCTAGATGAGTTAATATGGAGGAAGGAGTAC
AGGGCTGTGAATTTAAAAAAGAGTTCCTGGTCCAATCTTCCTCCCAAATCACCTTGTTGA
TCCGAAATAATGATGGGTCTACAAGGAGTTCTCTTAATCAGGACATAAAGTCTCATTCTG
TGAGTATCATCTTCCTGGTTTGTTCAGAGGTTGGCTTCCAGAGAGAGGCTTTGTCATCGA
GGATCAGGACCTAGAGGGAGAGATACACATGCCTGACTATAGTTACATGTGACTGTTCCA
CTTGACCACTCACCATAAGGTTGTGGACTTTGTCTGTAGCAGGCTTGGTGAGATGAGCAG
AGGCAAGGTAAGGAAGAGTGCGTGGAATGGCCAGAGCTGGAGTGTTAGTAGGATTGATTG
GGCATAGGTGTGCACCAACGGCCCGAGGAGCCCTCACCTAATGAGTAGAGGGAAGCAGTG
CACAGGACATGGCCCAGAGTCAGGTGGCCCCAAATGTCTGTAGTGCTGAGGGTGGGAAAC
TCTGATCTAGTATTTTCTTACTAGCGAGATTTTAATGAAATCTCTGAAATTATTTTATGT
ATTTGTGTTGGTGCTTTTCTTTTCAGGATTCAAAAGCCAAATAACCCCTCGTGGAGTTCA
GCTCAAGGTTTGAAGACTTCGTAGCTTGTCCTATGGACCTCAACACCAAGAACCACAAAT
TGCAAATTTAATAGGTCATTTTGTATCAAAAGGTCAATTAATGAAGCACCTAGAATTTTT
CAATTATATGACTATATTCTCTGGGTTCTGCTTTGGCCCAGACAGTGTGAACTTTTTTTT
CTATTGTGGGTTTTGATTTTCTTTTATCCCCCTTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3725..3918, 4862..4977, 6139..6278, 6759..6853, 7427..7564, 8778..8873, 10933..11205, 11580..11667, 11812..11931, 12437..12523, 12618..12745, 14154..14247, 14349..14479, 14727..14816
1001..1193, 3725..3918, 4862..4977, 6139..6278, 6759..6853, 7427..7564, 8778..8873, 10933..11205, 11580..11667, 11812..11931, 12437..12523, 12618..12745, 14154..14247, 14349..14479, 14727..14813
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved