Oryctolagus_cuniculus Locus ENSOCUG00000016934
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000016934
Oryctolagus_cuniculus
ENSOCUG00000016934
scaffold_178456
SNORD61
1154..1225
4792
AAAGTTAAAAGTTGGCCCTTGTCTGATGTAAGTTGCGCTGTTACTGAACTGCTTAACTG
AAATTGGATTCCTGCTGTTTTTGATGCCAGAAAGATTGTTCTCGATGTCTTCGGTTATTA
AGGAATAATTTATTTAAGGTAAAACAAAATATGCCACCCCAAATGTGTCCTATTAACTTG
AACTGTTTCCAGGGGGTAACACTTTTTGGTTTTCAACAGATTCACTGGGGTAAAAAAAAA
TGGTTGAAGCAGATCGCCCAGGAAAGCTCTTCATTGGTGGGCTTAATACAGAAACAAATG
AGAAAGCCCTTGAAGCAGTATTTGGCAAATATGGACGAATAGTGGAGGGTGAGTTATCTG
AAAGTATATACTGGACTATTAACATTAAAAGATAAGCTATGATGAATTTAATTGCATTGA
TCATTTGACATGATTAATTATTTTGTCCTCTAAGAAGTTCTGAGCTTTCTCTTTACAGAT
TTACTTTTGTCATTTTATTGGACCCTAGAGTAACACTTTCTTTGAAAACTATTTTTCAGT
ACTCTTGATGAAAGACCGTGAAACCAACAAATCAAGAGGTTTTGCTTTTGTCACCTTTGA
AAGCCCAGCAGATGCTAAGGATGCTGCCAGAGACATGAATGGAAAGGTGAGACTGTCTGC
ACAATGGATGATACTGTGTTTCCTGATGCATAAAATAGCACTTATCCAGATTTGGTCCAG
GGAAGCTTTTAAAATTTTGAGTCTGTATTCTGTAATTCACCACATTTTGTAGCCAAAGCT
ATGAGTTCTATTCTCAGTATAGATATATTTTGGGATCCATAAACCATAGTTGGGTAACTT
TGGTTATTAGTTTTTGACAAGCTAATAACCCACTTGATTTTGTTTTATGTTTACTAAGCG
CCACTTCGGAGGATCTACCTTATTCTTTGGTTCATATCATATTCTTTGAATAGATGTTTA
AGTAAATGAAAAAGGTCCCATTAATAGTAATACTGTGTCTTTGTAGACTAATTGGTGGGC
GTAACATACCTATTACTGTGTTTTGAAGGATCTTTCTGTCCTTTGTAGGTGAATAGTAGA
TCTGCAAGTTCTTGTAAAATCTTGGTATAACTCAGTGAATTGGATTTATTTTTTTTTTTT
AAGTCCTTGGATGGGAAAGCCATCAAGGTGGAACAGGCTACCAAGCCATCATTTGAAAGT
GGTAGGCGTGGACCACCTCCACCTCCACGAAGCAGAGGCCCACCAAGAGGTCTTCGGGGA
GGAAGAGGAGGAAGTGGAGGAACTCGAGGACCTCCCTCACGTGGAGGGCACATGGGTAAT
GACTAGTGGAATATGGGGCTTGGTGTGTTAGCTTTGGCTAAGTCCTTTTTGAGATTTTGA
GATTGAGAACACTTGTTCATCTACTGAACTAGTTGGGATTTAAAAAGAAAACATGGAAAG
CATCCCAAGTTACTGTTAATTTAAGTGGTGAAGCATAGACTAGGTGATTCATTCTAGGAA
AAGACAAAGTACCATTTTCTTTTTGATAGGCATTGGGCATATGAAAATGAAACCATTTGT
ATTTTTCTTTGAAGTACTATTTTTTAAAGATCTATTTATTTATTTATTTGAAAGGCAGAG
TTATAAGAGGCAGAGAGAGGGGTCTTGCATCCTCTGGTTCACTCCCCAGATGGCTACAAT
GACCAGAGAGCTCCAAAGCCAGGAGCTTCTGGGTCTCCCACGTGGGTGCAGGGGCCCAAG
CACTTGGGCCATCTTCTGCTTTCCCAAGGCCACAGCAGAGAGCTGGATCAGAAGGGGAGC
AGCCAGGACTTTTAAGACTACTGTTTTTCTATTTTCCCAGTCTATGTGACTTCTCATATT
CAAGTCTTAGAACTGATCAATGGAGCTAGACTCCCACAACTAAACAAAATTATCATATTC
TTGAAGAAGCAAGAAAACTTAGTTTTTTCTTGTTTCTTATGAATGCTAACATATTCTTTC
TTTTATTCTAATGTAGATGATGGTGGCTATTCCATGAATTTTAACATGAGTTCTTCCAGG
GGACCGCTTCCAGTAAAAAGAGGACCACCACCACGAAGTGGGGGTCCTCCTCCTAAAAGA
TCAGCCCCTTCAGGACCAGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGGTAAATGCTCC
TTGAATAACAGTCTGTGCTACCTCCATTAAACAGTTGAGGATGCCTAAATTTGACTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCAAATATGGACGAATAGTGGAGGTACTCTGATGAAAGACCGTGAAACCAACAAAT
CAAGAGGTTTTGCTTTGTCACCTTTGAAAGCCCAGCAGATGCTAAGGATGCTGCCAGAGA
CATGAATGGAAAGTCCTTGGATGGGAAAGCCATCAAGGTGGAACAGGCTACCAAGCCATC
ATTTGAAAGTGGTAGGCGTGGACCACCTCCACCTCCACGAAGCAGAGGCCCACCAAGAGG
TCTTCGGGGAGGAAGAGGAGGAAGTGGAGGAACTCGAGGACCTCCCTCACGTGGAGGGCA
CATGGATGATGGTGGCTATTCCATGAATTTTAACATGAGTTCTTCCAGGGGACCGCTTCC
AGTAAAAAGAGGACCACCACCACGAAGTGGGGGTCCTCCTCCTAAAAGATCAGCCCCTTC
AGGACCAGTTCGCAGCAGCAGTGGAATGGGAGGAAGAGCCCCTGTATCACGTGGAAGAGA
CAGTTACGGAGGCCCACCTCGGAGGGAGCCCCTGCCCTCTCGCAGAGATGTTTATTTGTC
CCCAAGAGATGATGGATACTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCGAGTTC
TCGTGATACAAGAGATTATGCACCACCACCAAGAGACTATACCTACCGTGATTATGGTCA
TTCCAGTTCACGTGATGACTATCCATCAAGAGGCTATAGTGATAGAGATGGATATGGTCG
TGATCGGGACTATTCAGATCATCCAAGTGGAGGTTCCTACCGAGATTCCTATGAGAGTTA
TGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAG
TCGCTATGATGATTACAGCAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTACTC
AAGCAGCCGAAGTGATCTCTACTCAAGTGGTCGCGATCGGGTTGGCAGACAAGAAAGAGG
GCTTCCTCCTTCTATGGAAAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAG
CCGCGGAGCACCAAGAGGTGGTGGCCGTGGAGGAAACCGATCTGATAGAGGGGGAGGCAG
AAGCAGATACTAGAAACAAACAAAACTTTGGACCAAAATCCCTGTTCAAAGAAACAAACA
AAGTGGAAACTATTCTGTCATAACTACCCAAGGACTACTAAAAGGAAAAATTGTGTTACT
TTTTTTTTTAAGTTTCCTGTTAAGTTCCCCCTCCATAATTTTTATGTTCTTGTGAGGAAA
AAAGTAAACCATGTTTAATTTTATTTGATTTTATGACATTGCTTTCAACAAGCAAATGTT
AAATGTGTAAGACTTGACTTGTTGTATTAGTGTTGTAATTTTCCAAGTAAAAGTTTCCCT
GAAAGGCCACAACCTATCTGATTTTTTTTTTCCCAGTAAATGAGGCAAGCAATTCTAAGA
CCTTCCACAAACATCTAGCCACCTAGTTATCCATTGATGTCCATTGAGAAATGACTCATT
CTACCCATACCAACAAGCTAGCTATTAGAGGGTGGTTGGGGTATGCTACTCTTAGGATTT
CAGGATTTCTTCAAACTGAAATCTCAAATGTTCTCAGTATGAAAAACCTGAGATCAGATG
CCTATGTAAAGAAAGTGCTATTCACCCAGTAAACCCAAAGAAAGCAAATGGATAATGCTG
GCCATATTTTGCCTTTCTGACATTTCCTTGGGAATCTGCAAGAACCTCCCCTTTCCCCTC
CCCCAATAAGACCATTTAAGTGTGTGTTAAACAACTACAGAATACTAAATAAAAAGTTTG
GCCAAAACCAACCATGAAGCTGCAAACGATGCTTGCTCTTACTGTTTCAAATTTTTGCAA
CTCTGTAGTGTCTCACTTTTAAAGGAACAGCTTGATTGCAAAGGAGAAAATAGATAAGCA
ATGAAGTTATCTCCAACTTCCTAAAGGCTTATGACTTCTAAAAAGTGAATCTATCAGCAT
TCCACATCAGATATAAAGCACCAAATGCCTGTGAAACAGCAAAGATGGTAAGCAAAGCAA
ACTAGTTTTTCCGTCTAAGTCGAAATTGAACACTTACCTTCCTCATAGTACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 1298..1404, 1902..2073, 2755..2907, 3917..4551
1001..1106, 1298..1404, 1902..2073, 2755..2907, 3917..4548
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved