Oryctolagus_cuniculus Locus RPL13
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RPL13
Oryctolagus_cuniculus
RPL13
scaffold_54263
snoMBII-202
1164..1244
2389
GCCCCGCGGCCCGCGGCGGGGGCCCATCCGGCCCATCCGTGCGCTGCCCGACCGTGCGG
TACCCACACGAAAGGTGCGCGCCGGCCGCGGCTTTCAGCCTGGAGGAGCTGCGGGGTGAG
TGGGGCGCGGGGCGCGGCGGGGGTTGGGCGGCCCGGGCTCGGGCGCGTGATGACAGTCTC
CGGAATCGCTGCATCGCCTGATGAAAGCGCGTTCGAACCCTTTTACCTCTGAGCGCCGAG
CCGGGCCCCGGGGGCCTGGCGGCGCGGGGCTCCGCGGGGCTCCATGCGTGCGTGTCTGGG
GCAGGTGGCCGGCATCCACAAGAAGGTGGCGCGGACTATCGGCATCTCCGTGGACCCGCG
GCGGCGGAACAAGTCCACCGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCG
CTCCAAGCTGGTCCTCTTCCCGCGGAAGCCCTCGGCCCCCAAGAAAGGCGACAGCTCGGT
GAGTGGCGGGTCAGCGTGTGCGGGGCAGGGCAGCGGTCGCACTCCCCCCGTGCCTGCCCT
CGGGCGATGTTTGCCCCACGCGGAAGGCATGGACTTCTGTGGGGGGTTGAGGGGCTTGAC
ATAGTTTCCGGGAACCGCTTGAACCTCTGCTGTGTTTCCGAAAGTGCTTATGGAAAAATC
CTGTAGTGGGGGTTGGCCGTGGCCACCTATGTGGCCTTCCTGGGGGTTGGACCGGGGGTG
GGATTGCTGTCTCCATCCTGGGTTTGCTGGCAGGTGGCTCACGTGTAGGACAAGACAAGC
TCCACTTGGGCCTGTCTTAGCAGCAGAGTTGAACAGCCCACAACCATGCGGCAGCACAGG
GTGCTGGGGTGTGTGATGGGGTCTTTAGCACAAGGTGGCTGACCGGGTTCTCGTCACACA
CAGGCTGAAGAACTGAAGTTGGCCACCCAGCTGACAGGACCAGTCATGCCCATCCGGAAC
GTGAGTAGAGGCGCACCATGCACACTGCGCTCCCAGGGCGGCAGGGAAGATCACCCCTGA
GTCTGAACCCTGGGGACCCCTTCCTGAGCCTGGGGGGTGGGAGTTCCCTGTGGAGATGCC
TGGCCCCTCCTCGCCATGCTGAGTCAGTCAGGGTGAGGCTCTGAATCCCAGCAAGGACTC
TGGTCTGATCCTCATCTGCCCCTGTCTCCATCAGTTTTGGCACGTGCTGGCCACTTGGTG
AGACTAGGTCTGACCTCGTCTCCTTTTCCAGGTCTTCAAGAAGGAGAAAGCCAGAGTTAT
TACAGAGGAGGAGAAGAACTTCAAGGCCTTCGCCAGTCTCCGCATGGCCCGCGCCAATGC
CCGCCTCTTCGGCATCCGGGCAAAAAGAGCCAAGGAAGCTGCGGAACAGGACATTGAGAA
GAAAAAATGAGGCCTCGCTGGGGACTTGCACAATAAATCCAGTCTGCCCGGTCTCCTGTG
GTGTGTCTCCAGTAAGCAGTGGCCTGAGTGCGCCAGGTCCTGTCTGGGTGTGGGGTCGTG
AAAGGCAGCCCAGACCAGTGGGCTGTGCCTTTGGCTGCCCTGTGAGACCACGGCAGTCTC
CAGGATGGGTGGTCCCTCGAGCCTGCCTCAGTGTGATCTGCGCCTGTGAGCATGGAGCGT
CCCTGCCCGGCCCCTAGGGGGAGCCTGAGGCTCAGCTCCTCGGCTCGGGCGCCTTTTGGC
CCTGTGGCTCCTGCGTTGGTCCCCGGGAGGTGCTCACACACGCCCAGCCTCGCCCTGCCT
GGACGTCAGCCTGCTGTCGCAGTTGCTGTGGCCATAGCTCCCGCAGGGAGACAGCGTTGT
TACCTGAACTCATCTAGAAATGATGCGTGTGATGCCCATCACCTGCCACTGTTACAGGTA
CCCAGGGTGCACCTGGTGGATTTGGGGCGCTGTGACCCGCTACTACGTGGGAGTCAGGGG
TAATGCTTAGCTGCCTCATGTATGTTGCAGCGTGGGATTCAGGACACGGCACCCCTGGCT
CTTGTCTGGGGCTCTGAATTGTCTGCTTGGTGTGGCGCAGGCCCAAGAACCTGCTTGGAA
GGGCTCGTGGCCCCCTGCATCTGAGTCTGGGGGTGGGCGTGCAGTGCTGCTGTGGCAGGA
GACCGGTTCCACAGTGAGGGTCTCCCTCTCACCTGTGCCACAGCTGGGGCGGGAGCAGGG
AAGTCTCTGGCTTGCTGTATGTGCCAGCAGCAGCCTGGAAGACGTGGGGAGGAGACGGCC
CGGGTCCTGTGTCATGAAGTGCCTGTGTGCCCCCGCACCTTGGGAGTGACCTTTGCCACG
GGCTCCTTCCCCAGGGGTCCAGCCGGATACCCACCTGGAGCACGGGAGCCACGCTGAGTC
TGCCACACGACCCAGGGGACTTGGGCTCCTTGTCCAGCATCCCCTGCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1020..1034, 1036..1060, 1062..1068, 1070..1090, 1092..1106, 1108..1111, 1301..1474, 1900..1956, 2228..2386
1001..1018, 1020..1034, 1036..1060, 1062..1068, 1070..1090, 1092..1106, 1108..1111, 1301..1474, 1900..1956, 2228..2383
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved