Oryctolagus_cuniculus Locus Poly:12:SNORA25
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:12:SNORA25
Oryctolagus_cuniculus
Poly:12:SNORA25
scaffold_215179
SNORA18, SNORA8, SNORA1, snoZ40, SNORA32, SNORA25
1001..1132, 1949..2087, 2414..2548, 2824..2896, 3265..3385, 3630..3761
4761
ATTATCTGCACCTCTGAAGGTGGTGTGGACAACCCCACACAAGTGGCTTAACCCATGGT
AAAACTGCCTCTAATTTTAAAGGCAAGAGATTGCACCCCTCCCTTTTGCCATTTCACTCC
CCAAATCCCTCATCAGCTAAGTAGAATCTGGTTGCCAGGAACTCAATCCATGCCTACCAC
ACCACACAGGTGGCAGGGACCTAAGCACTTAACTCCTGTGGGTAGCAGGAAAATTCCAAA
CAGAAATAAGGCATGCCAGTGTCATGTGGTGTCCTAAACACTGCTAAATACCAGCTCCAA
ACATTATTAAAAATCTAAAATGAAGACCATCATATCATAAACAAGCATTCATCATGTAAT
CTAGTAAATGATTACATGTACATGCAAGATTTCCTAAATACAAAAAGTAGAACAATGTAT
GGTCTTAAGTTTCTAGCATAAACGGTGTCACATAATTTATCTTTTCCTTATAGTGAAATA
CGTGTTTAAAAGGTGCTCTGCATTTTTTATCACTGCTCCCAAGCTGCTTGGTGAAAATCT
TTACCATGGGATTATGAAATGATCTGATTAAAATGGGGGTGTTCTGGCCGGCGTCGCAGC
TCAATAGGCAATCCTCCGCCTGCGGCGCCAGCACACCGGGTTCTAGTCCCAGTCAGGGTG
CCAGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCCGGGAGTGC
AGTGGAGGATGGCCCAAGTGCTTGGGCTCTGCACCCACATGGGAGACCAGGAGAAGCACC
TGGCTCCTGGCTTCGGATCAGCACAGTGCACTGGCCATAGAGGCCATTTGGGGGGTGAAC
CAACAGAAGACCTTTCTCTCTCTCACTGACTGCTCTGCCTGTCAAAAAGGGGGGTGGGTG
TTTTGTGCCTTTCTTGGTTATGGCTTTGTGCGTGCTTTTGCTGGAGAACTTCAACTCTGG
CTTTAAACTGCTTTTGTGTTGAATCCTAGATTGCTTTATCTGTTGAGGTCTATCCCGATG
GGGCTTTCCCTATAGCCATTCATCGTTGGAAACGCCTCATAGAGCAACTCTGTGGTTTTG
CTTTGCTCACAGGACTTATTCTTGGGTCTGTGGGAAGGAACTACAAGACAGTTCATTAAT
CAAAGTGTGAAAGACCTAATAGTTTTTTTTTTTTTATTAACCTTAGGTATTGGAATACCC
CAGATAAGTTTTATTTTTGAGTGATGGCTTAGGTAAGTTTTAAATGGTGACAGTGGAATC
TTTTGAAGTTCAATTACAGTTCACATGATGAATTTAAATGTTCAACTGCTGAATGATTAC
AGACATGAACTAAAACCTAATTCTGACCGAGCTGGATGTGGCTATAATACAATGAAATCT
CAAGATTTATATATGTATCGTCTAATTTTATAGCTATATATGTAAGGTCCCTAAATAATT
CATTTTGTACTTTTTTCACAGGAAAAAAATACAGCCATTCACATGGGTGGTAAGTTAAGC
ATTTATTTTGTTTTTCAAGGACTTGAATACAAAATCTTAATACACTATAATTATGAGTTA
ATAGATTGGCAAAAATATTTGGAATAAAAAATGAAAAATGCCTGTGTAGACCTAAGTGCC
ATTGTTTTGCATTAAATAATTAGTTGTCAATCTTAAGTGACAGTTCCACGTGGTTCATCT
AAAACCATGCCTACCTGGATATCTTGATTAAATAGGAATTGAATTGATAGAAATGTAACC
TTAAAAAGTTGACAGTTTGACCTTCAGTGTTTTTGACATCTATATTTTCTTATAATGACT
TAATAGTCATTTGTAAGAGTAGATAAAGATGACTAGGATAAAAGTTAATGTTTTTTCCGC
ATTGGATTGGAAATGTTTATAAAGGTCAGGTTATTTGTACTGGAATTTGTTTTATAGATT
GGCAAAAAGTGAAGGGCTTCAGTCATGACTGCACTGCATGGTATCTGCACACAGCAGTTT
ATTCCTGCTGGGGTGTTCAAAGGACAGTGCAATAGAAATTCAGTATCTGGCATCGTTGGT
TTTCTTGGCTTTGTGCATGTTAAACCTGGTATTTCTATTGATACAGTATTTGCTCTTTGT
TTGAGAGGTAAAATTAGGGAGAGAAAGAAAGGTTTTCCGGGACTAGAACTGGCGCCTATA
AAGGATGCCAGCACCGCAGGTGGAGGATTAACCTACTGCACCACTGTGCCAGCCCCAGCA
TTTGTTCTTTTCATACAGTTCACTTTGATGTAATCTTTAATGCTTTCTTTTCTTTTTCTA
GTGTGTCAAGAATCAGGCAAGTGCATCTACTCTATGAAGTAAGGCTTGCTTTTCTAGCTG
CTTGTTTCCTATAGTTGAGAGCATTGCTAGAGATGCAGAGACTTGCACAGTGAGTTTTAG
AGGAACATTCACTGGGCCTCATTGTAGATGAGAATGGGCACTGTTAAACATGGTGTCCAA
AAACTGTTAATGTGGCTAAATTGAGATACAGGTTATGCTTCCATCACAGCAAATGAATTG
CAGTGGTGACAATGAGACCTGTAACAATTCTGAAATTGTGTAGTGTGTTAATGTTGACTT
GTACAAGATTTCATATTCTAGGTCTGGGTCATATGCCAAAGTACCAATGTATTTTCTTAA
TTATTCCTTTCTAGAGCCCAAGAGTAAATTGCTTGAAGAAATTATATTCCAAAGATTTTA
GGTAAGGTTGACATAACCTCAAGTCAATGCAGGTAGATCCTGTTTCAGTCAAACCTGGTA
GTTGATTTAATACTACTATGAAAGAGTAGATTCCAACATGTCATGTGTGTATCATGATTA
AGAGTGATGTCATGATGATGGGCCAAATGTTCAACTGCTCTGAATGGGCTGAATGAAAAT
AGCCTTTCTGAACATCCACATTGAATGTATGCTATGCAATTATTTAGAAACATTTTAAAA
GCTCTAGGGTGAAAGCGAACCTAAAACCTGCATGTTTGAGGTATCACTGAAAGTAGAAAT
TAGCTTTCACTTACAAATTTTATTGTATTAGTTAAAATGAACTGGATTGGAACACATGCA
AGCAACAGCATTAAACCTAAAATTTCCAATACATAGTGGAGAAATGGGTTTTAGGATAAC
TTGGGACCTAATTTTCAAAGTTTGAAATATAAATTTTTTCACAGGTGGAATTTTGAAGTT
ATTATGTAATTCGAGTGAGGATTAACAGACCAGAAATTGTGGCAAGTATAACTGTCCTTA
ATTTTACCTATAAGTTGAAAGTTGAAGGTCATTACCAAGGCTTATAGAATGCAGTTTCTC
ATTTGCTGTGGACATGACCATAAAGAAATTTCCCACCAGGCTTTCTCTCTGCTACCTTGC
TAGCAATCAGCCTACTGGGAACATTTAATCAAGTTTTGCAATAGCCAGTTTCAAATTCTC
ACTACAGTGCATCACTGATATTTTTATGGGTTGCTAGTAGCCAGTTTGTATGTAACAGGA
TCTGAGGTATGTAACTAACCCCCAGAAATGATTCTTAATTTATGATCATCCCTGAAATTT
TCAATTTTCAATTCTTAATGTAGGGCTGGTACAACACGGTGAAACATCAGTTTGTTCAAA
AGGTACGTACACATGAGAAAAAAATAATAAAGGTCATTTCAAAGAGGGCTTGTGGAGCCA
TGAGACCAAGAGCTCTTAACGCTGTGACCAAAGACTGATGTTCTCCACAGGATGCCATAA
TCACTCAGTAGTAGTGCTGTGTTTTCCTGAGGAGATACAAGATTGAGCCACTCTTAATAC
ATCATGATGTATTATGACCAGTGTTGTTCTCTTTCTCAGGGCCGAAGATTTAAAAGAGCT
AACCAGATGACTTTGGACAGTGGAAGGAACTGCAACATGGGGACTTTCTTAATGTTAAAC
TAAAAATTTATTATTGACTTTAAATAATTTTGCCTTATGTTATACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved