Oryctolagus_cuniculus Locus Mono:202:SNORA41
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:202:SNORA41
Oryctolagus_cuniculus
Mono:202:SNORA41
GeneScaffold_5985
SNORA41
1001..1119
2119
ACTCCGCCCACAAGGGAGAGCTGGATACAGCTCCTGACTCCTTGGCTTCCCTACTAGCA
CTTGGATAGCAAACCAGCAAATGGGAACACATTCTCTCTCCCTCTCTCTTTCCTTATTCC
TACCCCATCCCTCTCCCTCTAAAACAAATACAATGTTTTGAATGGAAGTAGAGACACTGA
AGATTTACAGAAAAGACTCAAATTTCGAGAGATCAAAACTACAATGTATGAGATAAAAAA
CACACTGCATGAGATTATTGAAAGGTGAGACATTAAAAGAAGATAATGACTCTGAACACA
TAGCAATAAAATTATGCAAAATGAAACTTAGAAAGAACAAAAAGAAAATTAAAAGAACAC
CAGCAATATACGGGACACCTTTAAAGAGTCTAATATGGGTGCAATTAGGAGCCTCAGGTA
AGAGGTTGGGGAAGCAGAGAAAACATTTGAAGTAGCAGATAAAATTTTCCATATTTTGAA
GAAATAATAGATGAAAATTATAAATCCACAAGTCCAAGAAATTCAACAAAGTGTAAGTAC
AAAAAATAGAAAATAACTGCATGGCACATTATAATTACATTAATCAAAATGAAAGCGAGT
GAGAGAGAAACTTCAAAGAATCAGAGATAGAAGACATGAACATAACACAAAAATAAGTAA
TAATAAAAGTAAGAAGATAGGGAGCAACATTTTAAAAATACTCAAAGAAAAACTGTCAAC
CTAGAATTTGGTACCAGGCAAAAGTACATTTCAAAAATGCAGGTGAAATAAAGTCATTGT
CAGAGATGCAAAGACTGAAAGATGTCAAAAGCTGCAAGCATGTGTCACCAGCAGACTCAC
ATTGTGAGAAATGTGGAAGGGAATCCTGCAGGCACACCAGTGACACCAGACCAAACCTGG
ATCTTCACAAAGAAACAAAGAGCACCTAAAATGGGAACTCGCAGGAAACCATGCAAGATC
TTTTTGGTAACCTTCACCTCCCTTTAAAGGACAACTGACTGTTCTGCGACTACTGTTCTG
CACCTGTTCTCAGGGTAGCAGCTGTGGGAGCGAATGGTCACACAATCAAACACTTCTTTC
TTAACAAAGCAGAAAGTGGGCATATGTGTGACAGACATGAGATAAAATAAAGATAGAAAA
GATAATTGACTGCTTAAATAAATACAATAGCAATGTAGTGTAGTGCATATTACATATTAT
AAATAAACATGTGTATATAAGCACATATATGCATATATAGAGAGATGTAATATATATGAC
AACGATTACATAAAGGCCAGGAGAGGAGAAACTGAAGTGTATATTATTGGAAAATACTTA
CACTATATGTGAAATGGTATAAAGTCACTTAAAAGTAGATCGTGATGAATTAAAGAGGCA
TATTAAAAATCCTAAAGCAGCTATAAAAATTTTCAAAGACTTTCAATCAATACGCCAACA
AGATAGCTACAACTGAATCATTCAAAGTTTTCAATCTCTCCAAAAGAGGTTTAAAAGAGA
GGAAAACAGATCAAAAAGGAAACAAGTACGAAGTGGAAGAAGTAGGCTTTACACCTACAT
CTCGATGGTCACATTAAACATGAATTATTTAAACACCCTCATTAAAATACTGAGGCTGTT
GCTATGGATAAAATAGCAAGAACAAAGTAAGCACTGCTTTCAGGGAATAAACTTGAGAAA
CAAGTAAATTTAAAGTAAAAGAAATGAAATCTGGAATGGCTGTACTAATACCAGATAATG
TATATTTAAGAGAGGAGAAAACTACCAGGGAGAAAGAATGTCATTTCTTACTGACAAATT
ACCTGGTCTTCAAGAGGACATAAACATTTACGTTCCCCATAACAGAGCTTCAAAATACAT
TAAGCAACGACTAATACAACTTCAGGGGAATAAACAAAGTCACAATTAAAACTGAATATT
TTAATACACCTCTATCAATAATTGATAGAACAAGTAGACACAAAATCATCCAGGACCCAG
AAGATACAAACAACGTTATCAACTGAAAAGACATAATTCTCATGTCTAGAATGTTCCACA
CAGTAATAGATTGCACATCTTTTTCAAGTACACATGAAACATCTACCAAGAAAGTCAGGA
TATTAGACACATCAGTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved