Oryctolagus_cuniculus Locus Poly:29:SNORA73
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:29:SNORA73
Oryctolagus_cuniculus
Poly:29:SNORA73
GeneScaffold_5864
SNORA73, SNORA73
1001..1203, 1525..1729
2729
TTTTTTTTTGTAAGCACATTGATTATCCAGAGATTTTCTGACCAGCTTCCCTGCAGCAC
ACCCTGCAGACTAAGTGAACTGATTATGAAGTAAAAACTCTGCTACATACCTATCTGTCA
GAAAAACACATAGCCTGTTTCTGCGACTCACAACCCCCAGCGAGCACTGGCACGAGGACG
CCAGACCGGGAGACCGCTCTACTCCAGGTAGCGGCTGCCCCGATAGGCAGTCCATTCCCA
GGGGCCTTAGCGACTGTCCGATTCCCGAACTGCGCATGTGGCTGCGCAGGCGCAGTAGAC
ACGCCGTGACTTCCGGGCACTGCAAAAGGTATAAATACGGATGCGTTGCGCCGCTTCGGT
CTTTTATCCAGAAGCTTGGGCGGTGGTGTGTTTCGTCTTGGTGAGTGTCTAGCGTTTCTC
TTTAGTCCTGGATCTACTCTTTGTGCTCGGCAAGCAGCCTTTCCTGCGAGGAATGTTTTA
TGCTTAGAACTCGGGCACGCGACGAAGCCTGGCCGGTGCGGCCCGCGGCGGCCTGGCGAC
CGCGACCCTGGGATAGCCGCGGGGCCCGCCGCCCACGCCTGCCTTCTGTCGGTGGAGCCG
TTTATCTGGCTGCATCCTGGCGTGCACCCCCTCCGCGGAGTCGGGCCCCAAATGCGGTTT
CTAATCCCATCTCTCGCGCTTGACAACTGCGATTTCCAGCAGCTGGCTCCCGGGGCCGCA
GCCACTTATACGAAGTTTTAGTGGCTTAGCCCCGCGCTCTTGAATTTGGATTTATGGCTG
CCGCGCCCGGGTTCTTAACGTCCTGATGTACACGGCTTTGCCATTAGCTTCCGCAGGGCA
GTAGTAACCCGTTGAGCTTCTCAGCAGTGTTTCCTGTGGAACGAGTCGCCGGGGATTTAA
TTCTGGTCGCCGATGGTGTGACCGTGGAGGGGTTTTGGAGTTTCGCGTGTATGACCAGCG
CACTCACCCGCAGAGGAGACGCGTTACACGGGCTGGGCCGTCCAACGTGGACACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCACAGGGGAGCACAGGGCTCTGCCCGATG
ACGTACAGTCCCTTCCCACGCCGTTGGAGAGGAAGCGGGCCTCGAGTCTGCGCCTGCATA
TTCCTACAGCTTCCCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAAAC
AGCTGCCCGGAACATTCGGTCCGAGTAAGACTCCCTCCTATTTGCTTCATTGCATTGATA
ACTTACTTTGTTTTTGCAGAAATTCTTTCAGGATTCCAAACAACTTGTCCAGGGTGAGTA
GATCTGCTTTTGAGTTGGTTTTGGCTTACTGTTGGTCCGGTGGGTTTTTTGGGTGGTTTC
TTTTTAAATTCTCCTGGTTTGTGCAAGACAAACTGGTGCGTTTCTAACAGGCCTTCCTTT
TCCTTGTGTAGTTGGAGTTGAGAAGGGGTGTTGAAACTGTCCTGAGGGCTTGGGGTATTC
GGTTACCTCCAGTTTGCTGCTGATTCCAACGTGGACACCCCGGGAGGTCACTCTCCCCGG
GCTCTGTCCAGGTGGCATAGGGGAGCACAGGGCTCTGCCCGATGACGTACAGTCCCTTCC
CCCCCCGTTGGAGAGGACCCCCTTTTCAAGGGGAGTCTGCGCCTGCATATTCCTACAGCT
TCCCCTCGTACCGTTCAATGACTGGGAGACAAACCATGCAGAAACAGTCTCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACTGCCCTGATGGAGGAGGGGGTTTGTGTGGGGTTCAGGTGCTGCTCACTGAATCCTGT
TCCCACAGTGTAGCACAGGGGACGGTGCCTTAACAGCTGGATCTGGTGCTGGGGTATTTG
GACAGATGAGTGCTCTTGCTTGATGATGTGAGGAGGTTGAGTCACAATGACTCCATTGTC
AAGCTGCTGTTCTGGCTCCCAGCATTAAAGGATAAGCCCCTGGAGGATGGGGGCCAGAGG
GGTGCCATCTAGAAGGTAGGGATGGTGGGACAGCCATGACTCCAGGTCAAAGTGGGTGAA
TTTTATTAGTTGGAAGACACTGGTTATGAGCCGAGAAAGCTTGGGGTCTTGGTTTTAGGG
GTTGAAAGGCAGGACTTCATCTGGTTCGCTCCAAATGGCTACAGAAGCCAGTGTTGAGCT
GTCAGAGCCAGGAGATCAGGTGCTTGTCACTTGCAGGCATTCAGCAGGGAGTTAGAACAG
ATCTAATATGGCTCATTTGAGTGCCAACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved