Oryctolagus_cuniculus Locus Mono:68:SNORA16
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:68:SNORA16
Oryctolagus_cuniculus
Mono:68:SNORA16
scaffold_88275
SNORA16
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATATTTTTAACTTTTCAATTT
CTGTGTTCTATAATTATTTCCTTTCCATAGTATCCTCAGCTATGATTCAAATTCCTCCAA
GAACTTTTTTTAATCATCTTGCTTCCTGAATTATCCTTATAAGTTACATTTGTTTGATCC
CCATTCTTTTTGTCATTGACTCACTGGACACATTTGAAAGGTTCTTGATTGCCTGTTAAT
GTTTATGAGTGGTGACTAATTACTATCATGGGCAGAAAGGACACTCTTCTCCTACCAAAG
TTGATTTCCTACCACAAGTCTTTCCCCTGCATGGAAAAGCTGATGGCAACATCAGTGACT
GTCATCAGGGTATGGTCACTGGCAAGTTCACTTTAGGATGTACACTGGGTATTAAGCCTG
CCTATTGGATACCACCCTCCATACTGGCATAAAGAAGACTCTGTTCCAAATGACAACTCA
GAGTAGGAGCTCTAGGTCTCCACTGACAAATAGCTCAATCATTGTAGTGGAAAGTTCAAA
CTGTGCTATGGATGCCCATCTAGCACATGGGAGAGGGTAGCCCTATGCTCCAATAGCGAG
TAATCTGTAAGGAAAGGAGTAATAATGGTAGGGATTTGGGCACTAAATAAGAAATTCACT
ACATACATCTCTATTTTCACAGTTAAGAAATGCAATCCTGGTAAAATTTTGTTATAGGTA
ATGTTAGAAATATCTTTTATTTAATTTTTAATTTTTTTCCCAGAAACATTTTATTTCAGG
TATACAAACTTCACACATTTCATAAATACAAATTTAAAAACATAGTGATTCTTCCCATTT
CTAGCCTCCCTCACACTCACACTCCCACCCTTCTTCCTCCTCCTTTTCCTATTGCCATTA
TTTTTTTTACTAAGATCTATTTTCAATTAAATTTATACATATAAAATTAACCCTACACGA
AGTACAGAGTTTAACAAATAGTATGAAAAAAAAATATTTCTCGCGGCCCTTATCGAAGCT
GCAGCTGCTTCCACATAGCAGTTGTGGTCAAAAAGGAACCCAGAGCGACAGTTTTCCTTG
ACGGTCACCGTTCTGTTTGCTGTAACCGATCTGCAACATTTCAGGAAAAGACAGTCCTCG
GGTTGAGCCGGAGAGCAGGGTTAAAGTGCATCCCACAGGCTGCCAGAGACGCGGGGTCTT
GCATGGAGGGGTCAGTGAGGCCTCGGAGAACAGCTGCGGAGCTGTGTCGGGGGAGGTGGC
AGGGGAGTGGACGCTTGTCCTGGGAACATCTATCCAGGGGCGATTCTTTGGAATGCTGCC
TCAACACTAGGGCATCAGGGTAAGGACCAAAACTGGACAGGCCAGGAAAAGGGAGCAGGT
GGACAGCTGTGTTCTCATCGTAGGTGTGCCACGTGATGCTGGCAGACGTGGGGCGGTGAG
GACCCCGGCGGCATCCTCGGGCTGCCTGACCGGGTTTCTGAAGAGCCCAGCTTGCTGGCT
TCTGGAGCAGTGCCTTTTTTTTAGACTAAGGTCTACGCTACAGAGGATCTGCAGGGCTGG
ATGACTACTGAAGGGTTACGAAGTCTGCATAGCTCCACGCAGTGGCCAAACTGTGCAGCC
ATCACTCAGGAAAACCAACAGAGGGATGAAGAAGGCTGGCATGCAGCCTAAAATTGATGA
GGTTTGTGAACCAGAAGACCACGCCTTCGCCATACCCGTGTGACCTCATGCCCCTACCTA
GCCACACCTGGGTGCCCATCACCAGTCAGGTTAATTAACCACCTTTGGAAGTGGGTTAAA
AGCTTGGGTGTGTCTGTCCTGCCCTGTTTCCTAGCCTCTTGCCAGGAGGGGGCTGTGCCA
TCCACCCTAGGCTTCCTGGTGCTCAGTATGAACCCCTCTCTCATCCTATGCATCTTTTGC
ACTAAATAAATGCCAAAAATGTAAAAAAAAAAATATTTCTCAACAGTCGAGACAAGGGCT
ATTCAAAGTCACTGCATCTCTCAAAGTGTCAATTTCACTGCTATAGATTACCTTTTCTGT
ATTTTGTTAGTTACCACAGATTAAGGAAAACATATGGTATTTTTCTTTTGGAGGTTGGCT
AATTTTACTAAGGATAATGTTTTCCAGTTATATCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved