Oryctolagus_cuniculus Locus Mono:47:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:47:SNORA51
Oryctolagus_cuniculus
Mono:47:SNORA51
scaffold_165936
SNORA51
1001..1129
1807
AGAGCATTGGGGTTCCCTGAAGCATGGGATCAAGGGAATCAATATTAGCTGTAATTATC
AAGGAAGGGAGAACTGTCTATTGAGAGCTGAGAAGCAGCAGGTGTCCACCACTTCTGACT
TCTACCAGATCTGATGTGACTTATTGCTCAACAAGCATTTATTGAACAGAATGCTGAGAG
AGGGAGAGCACAAGACAGAAAGAAGTTAATCTTGGCAAGGTTTCCCCGTAGCCTGTGCTT
CCCCATCAGGGTCCTTTCTGGCTCCTGACACTTGCTCTGGGAAATTGCTTTATAAGTAAG
ATTCCAATGACTGCACTTGGTATGCAGAAATCTACCTCTCTCCTGGGAACCTCCTGTTCA
GATGAGACTGTGAACATTACAAACAAAAAGCAAGTGATGAGGAACGGTCACGTGCTGTGA
GAAAGGAGTTACCAGGGCACGGGTGATCCACCCTGGCTTCCTATCTTTGTCCCTCTGCGC
CTTCACTTCATCACTCCTCTGCAGTCTCTGCAAGCAAGAACAGCCAGCAGCCAGCCTGCC
CCTGAATTTTATACATTCAGTGGAACTTCCCATCTCCGTCAACCCTCAAAGATTTTTCAT
CTTAAAATTCAAGATGTGATTGTTCACGCTGAGTTTTTAGTATTATAAGTAATAATAAAC
ATAAAAATAGAGTGAACTCAGTCTCCTGGTGCTCACTACAGGCTGTGTTCTTAATCTGAC
TGTACAGAAAGAGGCAGAGTAAAGCTACCCCATATACACCTCGGCCCAGGCCCTGGGACT
GGTCTGTATTGTGAATGGGGAGACACAAGGGAAAAAAATAGAATGAATTCTGCTTCAGTC
ATAAGGTGGTTTATGAACCATTTTAATGATCTTTAAAGAGAGCGGACAGGCAGACTGGCA
GCATGCCCACCACAGCAGGTGGTGTTGGGCACAGACTCTGGACTAACAGGGAAGGTCTGA
GTTCTATTGTTAGCGCTACTGAATGGCAGTTGTGTGACCTTGACCATTAACCCCTCTGAA
CCCACCAGCTAATCAATTCTAAAATGCTAGAGTTAGAAACCAGCATTTGGCCTGGTCATT
AAGACACCTGCATCCCACATCAGAGTTCCTGTGTTCAATGCCGGGCTCTATCTGACCTCC
AGCTTCTGGTTACTACAGACACTGGGAGGCAGGGGTGATGGCTCAAGTGATTAGGTTCAG
AAGACCCAGATGGAGTTTCCCAGTTGCCAGGTTCAACATTTGCCTATTCTCAGCTATTGT
AGGTATTTGGGGGGAGTGAACCAGCATGTGTTTATATCTGTCTATCTCTGCCTCAAGTTT
TTTTATTTTATTTTATTTTTTTGACAGGCAGAGTGGACAGAGAGAGAGAGAGACAGAGAG
AAAGGTCTTCCTTTGCCGGTGGTTCACCCTCCAATGGCTGCTGCGGCCGGCGCGCTGCGG
CCGGCACACTGTGCTGATCCGAAGCCAGGAGCCAGGTGCTTCTCCTGGTCTCCCGTGGGG
TGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCCGGGCCACAGCAGAGAGCTGG
CCTGGAAGAGGGGCAACCGGGACAGAATCCGGCACCCCGACCGGGACTAGAACCTGGTGT
GCTGGCGCCACAAGGCGGAGGATTAGCCTATTGAGTCACGGCGCCGACAAGTTGACTGCG
TCTTGGTCACACTTCTGAACCTTCTCCTACGCCCATCTGTGCACTTCCTTGTAAGTCTGT
GTGTCAAGGACCCCCGCCCCCACTGATATGCACTTATCAGTCTGTGCCTATGCATGCAAA
CTCACTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved