Oryctolagus_cuniculus Locus Mono:72:SNORD45
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:72:SNORD45
Oryctolagus_cuniculus
Mono:72:SNORD45
scaffold_170324
SNORD45
1001..1071
2071
CTCGCTCTTCTCCAGTGTAGATGAGGAAACATCAGCCCAGAGAGGGAAATTATTTGGTC
AGAGGCAGGCTAAGCTTTCGGGAGCCCCGTGGCAAGGGTGGGGGTGGGGGTTGGAGTCCA
GTTTGCCGACAGACAGCGGTGGTGCGGCTGACGCCCAGGAGACACCGTCCGGTGCGGTTC
CCCTTTCTGCTTCCCGGAGGATGGTGGGGGCTGGGCCTTTTGTCTCTCGTGGGGAATGTG
AAATGCTGCAGAGAGGAGCAATTGTTCTTCTGTGCTTTGTGCTGCTTTATAAGAGAGAAG
AGATCAATACACATTTTCTCATACACACACTTGGCAGCCCTCCACCTCCTCTTCCACAGC
TCTGACTTGCGGGGGGCGGGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTCTTTTCCCTTGGTGTCTCCAACATTTCAAACATATGAAACA
GAACCGTCTCCCAAACAGTAGCAAAGCTGAGTTAGGGATTTCTGTCACAGTGATACTCGG
CTGACCATCAGCTAAGGTATATACGAGTGTTTCCTGCCAAGCTACCTGGATGAATCCTTG
CTTCCACGCTGTACCAAGCTTCCAGGTCATTGTGGAGGCGCAAACAAGCCTTATACAAAG
TAGACAATCCATGTGCAGCCTAAATATCTCTGTTTTCACTACATGGCCATAAGTCATTTG
TTCAAAGATTGCAAATTATATTTTAAAAGTTCAACAAATTAGGTAAGTGATGGAATGGCA
TGTATTAGCTGAATCACCATTGATATGAATTATAAAATTACACTGAGACCTTGAGGAAAA
AATAAAATTTAAACAAATAGTTTATTTTACAACTGACTTAGGCACTTAGTTAGAAACTGA
AGTGCTTTGCTCATTGTATGTAATATTATAATGGCCCTTTTTTTTTTTGCTTTTTTTTTT
TTTTTTTTTTGACAGGCAAAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCT
TTGCCGTTGGTTCACCCTCCAATGGCCGCTGCGGCCGGTGCGCTGTGGCCGGCGCACCGT
GCTGATCTGAAGGCAGGAGCCAGGTGCTTCTCCTGGTCTCCCATGAGGTGCAGGGCCCAA
GCACTTGAGCCCATCTTCACTGCATTCCCTGGCCACAGCAGAGAGCTGGCCTGGAAGAGG
GGCAACCGGGACAGAATCTGGCGCCCTGACAGGGACTAGAACCTGGTATGCTGGCACCTC
AGGCGGAGGAGCCTATTGAGCCATGGCGCCAGCCACGTGATATATCCTTTCAACTGAAAT
CAATGGTTCAAGGAAGGGGAAAAGTAAAGATAATAAATTTATTGCACCAAAGACCAGTCG
GCTAAATGAAATTACAAGTGAATATATAGAGACAGAATCACAACAATTGTGGATTTGGTC
ATTAGAATACAGAACAGACTAACAGCGAATATACAAAAGTCTAAATTGTTGAAAGCATTA
TATCAAATAAAGTATCAACCTGGATTATAGAAGTTTCTGATTATGGCAAATTAATACTTG
GACTCTCAATCTTCTTAAAGAAGGAATGGAATTGAAAAGCCTTGCATTTTGTCTATTATC
CTATACAGAGATCGATACTGTGCATAATTCCAACAGCCCTCCAAAAGTGTAGAGCCAAGG
GTTATGAAGAATAATAGACAGAGAAGCTATTTCTAAAATGTAGAAGACAAAAACATTATT
GAATCGCAGTTGAACTCCTCACAGTAACTGCTAACTGGTTTTGGGCATTTTCTGGGACTT
CATGTTTACCTCTAAACTTCCTCATTTTGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved