Oryctolagus_cuniculus Locus Mono:112:snoU2-30
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:112:snoU2-30
Oryctolagus_cuniculus
Mono:112:snoU2-30
scaffold_172813
snoU2-30
1001..1064
2064
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACAGTGCACATCAACAGGA
ATGAGACAGTAGGGTCAAGACCTGAAACTAGGCACTATGATACGGGATGCAGCAATCCGA
CTGCATCTCAGCTGCGCTGTAACCACCTGACCTGACAACGTGCTGACTGATACATGACAT
TGGGTGTATGTGCAAGTTTGTGTGTGAAGCCAGTAATTTCTAAGCAATGATGAAAGGTTT
TATGACTGACTAACTTTGAAGGTTTCTAAATTTGACTTAAGCTCAGAAATAACTGAACTT
AAAGTTTCAAGGGGCTGATGCCACCATGGCTAAGCCTCCGTCTGCACCACAAGTACCACA
CAGGGTGCCAGTTGGTGCCTAAGTGTTCAATGCCTTTGTTTTTCACATTCACTCAATCAC
TCATTAAACAAAAGTGCATTAAGAACCTGAAATATCCTTGCATAAGCAGAGTGTAATTCA
TTCTACTTGGTGCAGTGACAAATATTCAAGAAGTCTTCACAAATAAAAAATGACTTTGAA
CTGGGATGTTGAACCACTGGAAGCACAAATACCTTCAGAGTGTGACAAAGGGCTACCTAC
AAAATATCAAGTGTCAGGAAGATAACAGAAATGAGAGATGATGCTGTGTGTCAGACTTCT
CATCATGAGATGAGAAAACAAGTGTTTAGGGGAGAATTTTATGCACTCATTCCTGGCACT
CTGCACTCCAGCAGGTACACTCATTAACTTCCTGACTGCATCCATTACATGAATTACCTT
TAAGGGAGGAAATTTGCTCCAGGAAAAATCAGGTTCGGATTCAGATGGGACAAACGGCTA
CTTCAGAGCCTTTTGTAGATTTATGCCTCTTTATATTCACAGCAGTAGGTGAGAGTACAC
AAGAAACATATGTGCTTGCTCTTGGTGGTAGAGGACCTGTACAGAGGCCCATGGACAACT
GCATCCCCAAACTCTTGTATAAGATTATAGACAATAGTGGTACACAGCCAAGCAATTATA
CAACAGTTATATAACAGAAGTTATTATTATATACAAACAATTATATAACAGAAGTTCTGG
GTCTGCTGGTTGTCATGACTGAAGGACCCTGATTGATTTCACTTTCTTAATACTACCTCA
TCAACTCTCTACCTTTATAGTAAAGACAGCCAAGTGAAATGCAGAATCCTGATAGATCCT
TCACCGATGATGAGAGACTTTCCTTGTCATCGAAAGCTGAGGTGAAGTGGGTCATGCAAG
GAAGTAGAAAACATATCTGAAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved