Oryctolagus_cuniculus Locus Mono:76:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:76:SNORA70
Oryctolagus_cuniculus
Mono:76:SNORA70
scaffold_198158
SNORA70
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGGATGAAGCTCTTGGCTC
TTGGCTTTGGCCTGGCCCATACACCAGCTTTTGCAGCCACCTGGGGAATGAACCAGTAGA
TGGAAGCTCTCCCTTTCTCTCTTGCTTTTTCTCCTCTCCACCTCTGTAACTCTCGAATAA
AAATAAATAAATAAATAGGGCGGCACTTTGGCTCACTTGGCTAACCCTCCGCCTGTGGCA
CCGGCACCACGGGTTCTAGTCCCGGTTGGGGCGCCAGAGTCTGTCCCGGTTGCTCCTCTT
CCAGTCCAGCTCTCTGCTGTGGCCCAGGAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGC
CCTGCACCCACATGGGAGACCAGGAGGAAGCACCTGGCTCCTGGCTTCAGATCGGCACAG
CACACCGGCCATAGCAGCCATTTAGGGGGTGAACCAACGGAAAGGAAGACTTTTCTCTCT
GTCTCTCTCTCTCTCTCACTGTCTAACTCTGCCTGTCAAAAAAATAAATAAAATAAAATA
AAAATAAATAAATCTTTTTAAAAAGAGGAAAAAGAAGGGACATATAACACAAGGGGATAA
AAAGCACAGAACACTATATATGTTTTAAAAATAGTTTATGCCTGCAGCTAATTAAGCCAA
CCAGCTCCCTTTCTTCATGGGGTCCTGGTGTGCAATGGCTGCAAACAGCAGCCTCCTTGG
TAGTGTATGCAACCTATTGTTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCCCTTC
ACAGTGAACATGCCTCTGACCTCATGCTGCTCTTAATCTAGGCTGCAGACAGGTATGCGG
GGTGCTTTTGGAAAGCCCCAAGGCACAGTAGCCAGAGTTCACAATGACCAAGTCATCACG
TCCATCCACACCAAGCTGCAAAACAAGGAACATGTGGGTGAGGCCCTACTCAGGGCCAAG
TTCAAGTTCCCTGGTGACCAGAAGATCCACATCTCAAAGAAGTGGGGCTTTACCAAGTTT
AATGCAGATGAATTTGAAGACATGGTGGCAGAGAAGCGTCTCATCCCAGACGACTGCAGG
GTCAAATACATCCACAGTCGTGGTCCCTTGGACAAGTGGCAGGCCCTCCACTCATGAGGG
CTTCACTCCCCTGTGTTCCTTAATCATCGATAATAAAGCTTGATTCCCATTTAAAAAATT
AGTTTATGAGAGGCCAGTGCTGTGGCATAGAGGGCAAAACTGTTGCCTGCAGTGCCAGCA
TCCCATATGGATGTCACTTTGAATCCCAGCTGCTCCACTTCCAATCCAGCTCTCTGCTAT
GGCCTGGGAAAGCAGTAGAAGATGGGCCAAGTGCTTGGGCCGATGCACCCATGTAGGAGA
TTTGGAAGAAGCTCCAGACTCCTAGCTTCGGATCAGCCCAGCTCTAGCTGTTGTGGTTGT
TTGAGGAGTGAACCAGGAAGACCTCCCTCTCTCTCTCTGCCTCTGTCTCTCTGTAATGCT
GCCTTTCAAATAAATTAATTAATTAAAAAAATAGTTGATGAGTCTGGGGTTTTTTTCTCA
GTATTTTTAAGCCTCTGCCCATTGTTACTTTAATTGTATTGTTAACAATTAAAATATTCT
TTTCAGTTTAGACTCATATGTTTTCCCTTAAAAAAAAAGATTTATTTGAAAGGCACCCTT
CAAATGACTGAAACAGCCAAATCTGTGCCAGGCCCAAGGGTGGGGACCCAAGCATGTGGG
CCAGTCACTACCTTGCTTTCCCAAGCATATTAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved