Oryctolagus_cuniculus Locus Mono:153:SNORD53
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:153:SNORD53
Oryctolagus_cuniculus
Mono:153:SNORD53
scaffold_166323
SNORD53
1001..1076
1799
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAAAATATATTTT
TGCTCCTATCAAGCAAAATAGTTAATGGTTACTGCATTCCCAAATGAAGGCTTTTTAAGA
GTTGTTCGTTTTCCCATTAAGAATTCCTGAGGGATTAAGGTGTAATTTCATTTTCCACCC
TTCTGCCATTCCCCACGTGACAGGTGTGGACCCCAGTGATGAATGCAGAAGAGAAAAGTT
CTGGTGCCCGGGGCTTCCAGGGCATCATGCGGGCCATCAAGCCTGCTCCTCCACCAGCGG
AGGGCAAGGAGAGCAAGAGGAAGTTAACGGGGAATGAGGTAATGCAGCTGCTTGCACGGG
TGTGGATTCTGACTGAAGAGGACTTGGGAGATCCTCACCTGCGTGCTGGGGGTTTGCGCA
GCTGGCTGTGGTCGCTGCCTCCACACATAGGGTGAGCAGCTCTGAAAACTGGTGCTGAAG
TGGAATTTTTCAGGTCTGTGTGTAGACTTTCATCATACGCATTTTCCATGACCTTCTTGT
ACACTCCTTGTGGATCCCCAACTTCTAAAGTGGCACTTCTGTCAAACAGTTGGCCACTGT
ACTCACTGTTGAGCAGATGGAGCTCTTATTACCTGCAGAGGGCGCTGTTTAGGCCATTGT
AGCAGCTGGATGACGCGACGCTGAGTGCACTGAGCTGGGACTTGCCGTGATGACTTCCGT
TGGGTTTCGCATGTTGCTGAGCCCCAGTGATGCGTCCTCTCTTGGCTGTCTGAGCAGTCC
TCGCTCTTCTAGGACCAATCGGTCCTTACAATGGTAGGCCCTGGGATCTCTGGAAGTGGA
ATCTCTTAAATCCCACTTTTCCTCGGCTCCCCAGCCCCCGTGTGCTTACTGCCTGTGTCT
GCAGAGTGCTCTCTTCGTCTTCCAGCAGCCCCCACTCCTCAGGATTCGAGCTGTTTTATC
CTTACAGAAAGATGCTGCTGCTTTAGTGAGTTTTAAATAACTTACGTTTTTGGGGTTGGC
GACAACATAGCTGTTCAGGAAAATTGTTCTCCAATAAGGGGTTATGTGGCTTTAAAAATA
AACTGCCAACTTTATTTAGCTTAGGCCAGACTCTACTCCTTCATCTCTTTGCTTTGTGTG
TGTGTCTGCCTTTTTTTTTTTTTTTTTTTTTTGAAGTAAATTGTTTTTCATATGTTAGGA
TGACCCATACAGGGGGCTTCACCAGGGCACAAGGGTTCCCGCTGTCACCACAGGAAGGAC
GTCTGATTTGGCTTACTTACCTGCGGGCTGGTGGGGTGCGGTTTGTTAGCCTTGCTTTAT
TCACAGATCAGTTCTCTACAGTTGGGTTTTTGTACAGCAAATTCTGTGATATACACTTAA
ATTTTAGGATTTTAAAAGCCCTTTTTTAAATTGGCTCATCATAATTGTACATATTTATGG
GGTACAGTGTGAAGCAACAGGCACCTGTAAACTGTGTAGTAATCAGGGTGTTAGTGTATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved