Oryctolagus_cuniculus Locus Mono:206:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:206:SNORA70
Oryctolagus_cuniculus
Mono:206:SNORA70
GeneScaffold_5415
SNORA70
1001..1128
2128
CAGCTAGCTGAGAGGTTCTCAAAATCTATTCCACAAGCTAGAAGCATCCACAACACCTG
AGAACCTATTAGAGGTGCAAATTTTTGGACCCTGCTCCAACCTACTGAATCAGAAACTTT
GGGGGCCCAGTCCAGCAATGGGCTGAAGTTTAATAAGCTGTCCAGGTATTTCTGAGGAAT
GCTAGTTTGAAAACTACTGGGCTAGTTATCTAGATTTAATTCTTCTATTTCTCTGTGCTC
CTCTGTGCTCTTCCATGCCATCAATAAGTCCTTTTTCTCTAAGATTCCTTAAGAAAGTAG
AGAAGTTACAAGACAGTATTTTTCTCATATTTCTTTCTTCTTAAAAAATGAATTTTACTG
TGCATATGTGAGGTTCACAACATGATGTTCTAATGTACTTATAGATAACAAAATAATTAT
GATAGTGAAGCAAATTAGTATTCCCATCATACTCACATACCTTTTTAAGAGAAAAGAGAG
GCCAAAATCTACTTAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
TCCTCATGTTATGTCTCCTTCAAAACCATGCTACTTTGAGAAGGAAGAAAAATGTTGAAA
AGGGGTCTCCAGAGGCTTGTGCTGTAACACAGCAAGTTAAAGCCCCAGCCTGCCATCCCA
GCACTCCATATGGGCACCACTTAAAGTCCTGGCTGCTCCAATTCCAATCCAGATCCCTGC
TAATCCCTGGGAAAGCAGTAGAAGATGGCCCAAGTCCTTGGGCCCCTGCACCCACGTGTG
AAACCTGGAAGAAGCTCCTGGCTCCTGGCTTCAAATCTGCTCAGCTTTGGCCATTGCAGC
CATCTGAGGAGTGAACCAGCAGATGGAAGACTTCTCTCTGTCTCTCTCTCTCTCACTCTC
TCAATCTGTAACTCTGCCTCTCAAGTAAATAAAAAAAAATCATTTAAAAAAAAAAGAAGA
AGAAAAGAAGTGGGGCTCCCAATGTACAATGGTTGTACACAGCAGGCCCTTGGTAGTATA
CAAAGTCTGTTACTTGTATGGGTTGCCCAAAGGCACTGTGGAGACAGATATTTCCAATAG
ACCTTCTTATGTCTGACTGCATGCTGTTCTGGTCTGAGTATGCACGTTCCTTTGGAAAGT
CAGGGCCCGGTGGTGAGAGTTCATGACAGCCAAGTCATCACATCCATCTACACTAAGCTA
CAGAAAAAGGAGCATGTGACTGGGGCCCTACAAAGAAGCAAGTTCAGGTTCTGGGTACCA
GGAGATCCATATCTCAAAGAAGTGGGGTTGCACCAAGTTTAATGTATATGAGCTTGAAGA
TATGGTGGTTGAGAAATGCTCACCCAGATGACTGTGGGGTTGAACACGTCCCAAAATGTG
GGCCTCTGGACAAGTGACAGGCCCTGAACCCAGGAGACTCCCACTCTGCTGCCCTTTCTT
AGATCATGCTAACTATTAAATCCTACTTCCTGTTTCCTGTCCAGCTTAAAAAAAAAGAGA
GAGAAATGGTAGTATGCTTTGCTGTGCAATATAGTGTTAGAAATCTGTGTGAATGCAACT
GTGATTAGCAAATATATATAGTTATATATAATATATATTATATACTATGATAAGTAAATA
TATATTTATATAAATATGTGTATGTGTGTATATATATATATCTATATATATATAGAGAGA
GAGAGAGGCAGGCAACAGGTGTCAGAAGAGAAATTTAGGAAGTTTTGTTCAAAGTTATGA
CTGTTGTCCTCCTGCCCGGACATTTTCAGAGGACAAACCTTTTGGTAGCTAGACTGTTTT
TCTTTTAATTCAACACCATTGGGACTGGGCCATACAGACAGCAAATATCCAGGCTTTAGC
AGCGAGTGCCCTGCCATACCGAATGTATCACAAGACAACACAGAAAAGCAGCAGCAGCCT
CATTTTCAAGCCCCTCTGCCTCCTCTGAGCTGTTGTTCACTCTTTCTTCTATTTTTTAGC
CTCTTTTCTCCATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved