Oryctolagus_cuniculus Locus Mono:140:SNORD22
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:140:SNORD22
Oryctolagus_cuniculus
Mono:140:SNORD22
scaffold_174016
SNORD22
1001..1123
2123
GAAATTTGTAAAAGAAAACATAGCACTCTGTTGATAATGGTTTTGGATAAATAATATCT
TCATTTTGCACAAGCAGATAATAATAAAACATGTTAGGGGACTAATGAATATATTATGCT
CCATCTCGTTCTCTTGGTTATATAGCTTTAATGCAATCTATCTATCTATCTATATAAAAA
TCAGTAAAACTCAGTGTACTAAGTACTCAAAAAAAGGAGTAGGATGTAATTCATCAGGAG
GATTATGTCAGGGATTTCAATGATTGGGAACAGCATGAAGATTGACAGGGAATTATGAGA
AATGAAAACACAAACCAAATTGGGAAAAAAGATAATTCAGAGTACTTGAATAATACTCTC
TGTAAAACCATGTAACCAGATATAAACTGAAATTTTGGGAAGGCAAGTGTGTGTTTGTGT
GTGTGCATACACCTATTTTCCAAGAAGTTTGTGCTGTTTTTACCAGGTAATGTGGGAAGG
CTCAAGAATTTACTTAAAATACATTATTTTCACCTTGTTAATATAGAAAGTATGTGAAAA
GTAGATAAAAATACCCGATGACAAGGGCCAGGGCTGAGGTTTAGTGGGGTAAGCCATCAC
CTGCAGCGCTGGCATCCCATATGGGCGCCGGTTCCAGTTTTGGCTGCACCACTTCCAATC
CAGCTCTCTGCTATGGCCTGGGAAAGTAGTAGAAGATGGCCCAAGTCCTTGGGCCCCTGC
ACCCATGTGGGAGACCAGGGAAAAGTTCCTGGATCCTGGCTTCAGATCGCAGAGCACCTG
CCATTGTGGCTAGTTGGAGAGTGAATCAGCCAATGGAAGACCTCTCTCTCTCTCTCTCTC
TCTCTCTGCCTCTCCTTCTCTCTCTGTGTAACTCTTTCAAATAAATGAATAAATAAATAT
TAAAAAAACAATGACAATTTTGAGTTTGAAGAAGGTGAAAATTCAGATGCAGTAGCCAGC
TAAAAATAATTAGTTTCATAGTTTTTTAAAAGGACAAAAATCTCCAATGAGGAACAGACA
TCCTGTCTTACTCCCTATTTTAATCCCAGAGCCAGTAATGGTGAACCCACTGGGGTGACT
GGGAGATGGGATGAGCACTGGTTCTGTAAGGAACAGTCTAAAGCACAAAAAATGCTTAGA
GATAGCAGTGACTTGGTTTTCCTTGGTCATCCAACCACAGCTACATTAGGCTACCTTTAA
GCCATTCTGGATATTTTGCCAATTAAATACTTTTCTTTTATTATTTCACTAGCCTCTTGT
TCTTATGCTCCACTGAGAACTCTTCAGAGTGAAGACGTGCTATCACCAGTGGCCTGCTTG
TTGGTTCAAAGGTCCCTAGAGCCCAGGATGTGATTCCAGGGAACCTAAGCTGTATTTCTG
CTGAAGTTACTGGTCTGAAGAAAACACAGGTGCGAGTAAATGGACTCCCAAGTATTGGAG
GATGTCAGAAATGAAATTTTTAAATCCTTAAGACAATCATTTTAGTCTTTCTAATGAATC
TGCTTTCCTTAAAAAAAAAAAAGAAAAAAGACAAGAATAGATGACCTGGAGATAATGAAA
AGTGTAAGTCTATTAAGCTAACTCAACGTAGAGGTTAAGAATATTTATGTGTAACTTCTA
GGTGTTAGGTTTTTGGGATATATTCTTTGAAAATATATAACCCTAAAACAGGAATATTGG
AATTGAAAATTGATCATGGGGTCAAATGGGAAACACAGATAATGAAGTAGAAAAAAGGTG
AGACAATGGTTGTTGCACATTTTGATTTATTTCTCAATGACATTACCTAACTCTGAGCAG
TGTAATTTTCTTCAGTTTCATTTTATCCACAATGATTAGGGTGTTTTAAAATATGACCCA
GGTCTAATATTATGTGTTTTATGTTAGACATGTTTAAACCATCCAAATTACAATGAGCAC
AATGAAATTTAACTAGTGCAAAAACTATTTAAGGTGAAAAAGGTCAAATTAAATTTCCTA
GTTCTGTCTGTATCTGGTATTGCTCCCCCTCTTCGTGGAGGAACGACACAGGACCCTGCG
CTGTTCTTTTGTCTGCTCGGCCCTTCCCAGGTTTGCTGCTGGTTCTTCCCGGGTTGGCTA
CCGTCCCTTCCACCTCCGTGGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved