Oryctolagus_cuniculus Locus Mono:149:SNORA68
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:149:SNORA68
Oryctolagus_cuniculus
Mono:149:SNORA68
scaffold_25552
SNORA68
1001..1131
1645
CTCTCTCTGTAACTCTGTCTTTTAAACAAATAAAATAAATCTTAAAAAAAAGTCTCAAT
AAAGTGAGCACATTCTAAGATTTTATTTAAGAATCGGTTTAAATGTCTTTTACATGTAAT
ATTTGCTACATATAAACCTTGCAGTACTCACAGGGTACTTCAAAAAGTTAATGGAAAATG
GAATTAAAAGAGAAGTTTATTTTGGTGCAATATATTTTGAAAACCATGCATATGAGAAGT
CTTCAAAAAAAGATCATGGATGGACTGGTGCTATGGCACAGAGGGTTAAAGCCCTGGCCT
GAATCACCAGCATCCCATATGGGCACCAGTTCTAGTCCCAGCTGCTCCACTTCCAATCCA
GCTTTCTGCTATGACCTGGGAAAGCAGTTGAAGATGGTCCAAGTCCTTGGGACCCTGCAT
CCATGTTTAAGACCCAGAAGAAATTCCTGGCTCCTGGTTCGGATCGGTGCAACTCCGGCC
GTTGTGGCCATCTGGGGAGTGAACCAGTGGATGGAAGACCTCTCTCTGTCTCTGCCTCTC
TGTAACTCTGTCTTCCAAATAAATAAAATAAATCTTTTTAAAAAATCATGGAAATATGTG
AGACCTATGCATGGATTCAAAATTTTCCCATCAAAATAAACCTCTTTCAATTCTATTTTT
CCATGAACATTTGAAGTACCCTTATAAATGCATATTCTTCACTCCATAATTATAAATTTT
TAAAGAAACTGGCACAGATAAAATCATCCTTGATTCTTTCACCTTAATCCAACCTTCTCC
TACTTTTTTGTTCTAATTCATTTCTCTTTGCACAGGTATAGCCATAGTAAACACTACCTA
CTTTCTGGAAGTATTCCAGGAAGGCAGTGAGGACACAGCAGTAAAGAGAATATATTGAGT
CCCTGCACGTAGTGAGAAGAGAAAAACAGTATCAGGCAGTAATGTATAAGGCAACTCTAT
GAAAGTTACATCTGAGGTTTTGTTTTTTAAAGATTTGTTTTCAAGCACCCGAACCCCAGA
CCCGCCGTGCACCGTGGCCACGGCTCCAAGCGGGTGCAAACAGCAGCGGGGGCCTCGTCG
CCTCTGAGGGGCTGTGGGTGCCCCCGGGAATGAATGTGGAGGCCGCACATGCGCAGAAAA
AAATAAATAAAGATTTGTTTTATTTATTTGAAAGGCAGTGTGACCTCAAAAGAGAGAGAG
ACTGTCCAACCACCATTTCACTCCCCTAACAGCCAGGGCTGGGCTACACCAGGTCTCCCA
GGTGGGTGACAGGGGCCTAAGCACTTGGGCCATCCTCCGCTGCTTTCCCAGTGCATTAGC
AGGGAGCTGGATCAGAAGCAGAGCAGTGGAGACTCGAACCTGAGCCCATATGGGACATCT
GCATTGCAGACAGTGGCTTAACCCGCTACACCACCATGCTGACCCTGAGCTGAGGTTTAA
AGATGAGAAAAAGACACCCACTTGAAAAGCCTTAACAATGTTCAAATGAAAAGGAAAGCT
CTGTATGAGGAATAGAAAAACAGCCATGATGCCTACAGCGAGCATGGATGTGGAGAGGTG
ACCTCTGAGAAGACAGCAGGGAATGGATTAATGAAGGATATATAGAGGTCATTTTATTCT
AAGGCCAATCGGGAGTCATTAAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved