Oryctolagus_cuniculus Locus Mono:228:SNORD65
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:228:SNORD65
Oryctolagus_cuniculus
Mono:228:SNORD65
GeneScaffold_1820
SNORD65
1001..1074
2074
TGCCGAGTATGGGTGCCCCGAAGTTGCCTTTTTATGGGGAAAGCAAGGAGGGAATGGTG
GTCTAAATGACACCAATGTATTTCCATATGCATGTGGAAGGCACTGTGCAATCCAGAAAC
AAAAAGTTTTAGAAAACAAATCAGTTGGTTGAAATAAGCTTGATTTTGCTCATTTGTTCT
TCTAATTTCCGCATCAGATCAAATTTAAAAACACACTGGCAAATGTATCAGCCTCAGAAA
TAACCTGACAGCTGAGTCTTCTACAAGGCTGGAGACTGAGGGGCTGGGACTAGGGAGGGT
TGGCTGGCAGCCACCTGGCAGTCAATTCTCTGTACACAGAAAGGAATGGCTCAGGCTAAT
GAAGCAGCTTAAGTTACTTAAAGGCATTTAGGTTACAAGCTATGCAGTAGGTGGGGTATG
CCAGCCACAGACAAAGGGAGCCTCCCGCAGAAAATACACAAAGAAAGTGTGTAGAGAATA
CGAAAACAGAGAGAGACCATTTACCACTTCTTTCCCAACCTCCCATAAAACCAAAACATT
GTATGGCACATGTCAAAACTAGCAGCTATAAAGTTTCAAATGCATAAACAAAGCTTTGAG
TTCTTAATTATGCAATATATCGGAATGTTAATAAGCAAGAAAATGCAGTAGGTTTTTTTA
AACCTATAGAATTAACCACTTATACACTGTAACTTAATGACATGTGATGATTTGAGAAGA
TGCAAGGCCTTCAAGTTAAAAGCTGTTACCAAACCTCTTACTCTAAAATCTGGGTGTCAT
AAATATTTTACACTAGAAGTTAAAGGGGAGGGAACAAAAAGGAGAAAAAAAGTACAATAC
CTCTGGATTCATTATTCCTTCTTTTTTAAAGCAGCTGTAAAACATGTCCATGGAAAACAC
TTCACTCCAAAGATATCCATAATACTGGCCATCGTATCCCCCTGCCAAATGCCCAAAAGT
AGCTGGCATGTTTGTTCCTTTAAAAGAAGGACACATAACATCAATGATGAAATCACCGAA
AAATAGCTGGAATTACCGGCAGATTGTGTGGTGGTGAGCCCAAGGTCTTCTGAAGAAAAA
AAAAAAAAAAAAGAAGGACACATATCAATCAGTGTGATACCAAATGCTAATTACTAGGTT
GTTAGTCAGCCAAGGTTTCCCTCTGGAGAGTCAAGCGGTGGGAGGAGAAAGTGAATGAGA
GGCTCTCACCCCAGCACGACCAGGGCGTAGAGGTGCGCCTGGCTGCCATGTTGACAAACT
TCTCTCCTGTCAGGGGCTTGCCCTCAGAGTTGGTTTCAGCCTGGCTCTGGAATGCCTGAC
AACAGTGCCAGAGGCTTCGTCCACACCCATCAGAGAGTCAGTCTTTTCTCATCCTCTGCA
CACTTCTGCTTCTTAAGGACACTCGAATATTAACCCTGCTCTCTGCTATACCTCTTCATA
TCTAAAATGTCTGAGAACAGCACTTACTTTAGGGTGATAATTACTGAACAAGAATTCTTA
ATTTTAAAATTGTGAAAGGTAACTTTACAAGCAATTTTGTCAGGGCCGGCGCTGTGGCAT
AGAGGGTAAAGCTGTTGCCTGCGAGACAAGCATCCCATATAAGCACCAGTTCAACTCCCT
GCTGCTCCACTTCTGAACCAGCTCCCTGCTAACAGCAGGGGAAAAGCAGTGGAAAATGGC
CCAAGTGTTTGGGCTCCTGCACCCGTGTGGGAGACCCGGATGTATATCTTGGCTTCTGGT
TTAGATTGGCCCAACTTCAGTCATTGCGGCCATCTGGGGAGTGAACCGGTGGATGGAGGA
ACTCTCTGTCTCTCTCTCTCTGTAACTATTTAAAATAAATAAATAAATCTTAAAAAAAAG
GCAAAATAAACAATTTTGTCCAAGTTGCTCTATGATTGACTGTAGAGAGATCACCAACGG
AGGCAGAGCCCAGACTGAGTCAACTGGCCATTCTTATCTTTACTATCTCTACAAATGTCG
GTGATTCATTTTTTAAAAAAGGCTTTAGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCC
GCCTTGCGGCGCCGGCACACTGGGTTCTAGTCTCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved