Oryctolagus_cuniculus Locus Mono:212:SNORA44
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:212:SNORA44
Oryctolagus_cuniculus
Mono:212:SNORA44
GeneScaffold_2082
SNORA44
1001..1131
2131
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCAAAATAAATAAATAAAGCATCATTGCCCTCCAAGGATGAAAATCACCATTTAT
TTTTAAAGATGGGGATGAGGGGAGGGAGAGAGGGAGGGAGAATATGAATGAATGAATATG
AATCTTCAATCTGTTGGTTCACCCCCCCAAAGCCAGAAGTGGGCCATGCTGAAGCCCAGA
GTCAAGAATTTTATGTGGGTTTTCTACATTCTGCCATTTCTTTTTCTATTTCCATTTCTC
ATTTTATTATTTCTTTCTTCCTAACAAGCTATGGTGATTTTCTTTTACTAGTTTTTACTG
CTTTCAATAACATCAAATACACTTAAGACTATTAATCCACCCAAGCTGTGCTTTAGCTAG
CACCAACATTTTTACTACTATTACTTTAACATTCACACTTCAACTCTGCATTTCCACTTT
AACACAAGTTATATAAAAGCACATTTTCATACTTACAAGTATAAAGCAATTTGGAAGGAG
AATTTACTTTATTATACATTTCAACATTAAATTGCATTGTACAGCATGTTTCCAAGGGCT
GTGGCTGGCTGTGGCCATGGGATCTCCAACTGCATGCGAGAGCAACCTGGAGAGACTTTG
ACAGCTCAGGTCAGCACTGTACCTGCAGCTGCCACTCGCCTTTCCGATAATTTCAGGACC
TGCCTGGGGGTGGGGGTTCGTCCTAGAAGCCCTCACTCAGCTTTTTGTTAAAAAAATTAA
AAAAAAAAAATTGCATTGTAATCCAAGAGCAAGACATTCCTTAAAGAACACCTTCAAGAT
TATCTTTTTCCAAAATTTCTTCAATACTCTACAGTTATATTACACTCTTCAATTACCTTG
CTCACTACTGGGAAAAGATTTTGGATCTAAGGAAATTTATCTGGAAATTCCTGTCATATT
TAACATATGGGTGTGGTTCGAGACCTGGCTGCTCCACTTCCAATCCAGCTCTCTGCTATG
GCCTGGGAAAGCAGTGGAAGATGGCCCAAGTCCTTGGGCCCCTGCACCCGTGTGGGGAGA
TCGGAAGAAGCTCCTGGCTTCTGGCTTCAGATCAGCTCAACTGTGGCCATTTCGGTCATT
TGGGGAGTGAACCAGCAAATGGAAGACCTCTCGCTCTCTGTCTCTACCTCTCTCTCTAAC
TCTGTCTTTCAAATGAAAAAATAAATCTTTAAAAAAAAAAATACTTATTTGATTCATCCC
TTCCCATCTAACGTTTTCTGATTACCTCTGCCCATCCTGAGCACCCCATCACAGAACGAG
ATCACATAATCAGGCTTAGCATTTCCCTCCCTAAGACAACACTGGAAATCTTCACCAACC
CAGTCAGCTGACACTTAAATTCAGGTGCTGGTTGTAAGGACCATGTCTTCTCCTTTCCTT
CAGCTCTTGATTTTCTGTAAGTGAAGGTTTAATATAAATTATCATTTAAACTAGGATCCT
GCTGGATACCAAAGGATTCTCAATTAGTAACTGCATGGACAAGTATACTACTGTAAGTAT
AAACTGAGAGTCTCAACGACAACTTGAGAGATGCGTGATTACTTGGAACATAAACCTACA
CAGTAGTTATTGGCAACCATAGCCCCTTTTACACATAGGGAGGCTGTTAGGCCCTGGCTT
CATTTACTAAGTCTAACTCCATTCCCTTAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved