Oryctolagus_cuniculus Locus Mono:33:SNORA72
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:33:SNORA72
Oryctolagus_cuniculus
Mono:33:SNORA72
scaffold_173553
SNORA72
1001..1117
2117
ATCAAAGAAGGAGGTACTTTTCTCTGAAGGGAGAAGAGGACTTCCACTTTGCTTATGGC
CTTGTCTAAATACTGACGGAGTTTGTGGACTCAAAAGATTCCGTAGATTTGGCAGCTCAT
GTCAAGAGCCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGC
GGGCACCTGCAGCATCAATCCCCACAACAGAGGGGTCGTGTATGGGAGAAAGGACTTGGC
CTTCCTTCCCTGGGCCTTCCTTGTCCTCCCGGCTTTGTGCCAAAGCAGCCAGGCTCCTGC
CTCCTTTTAAAAACATAATTAACACTCTCAGTGGGGTGAGCAACTCAGATTACTCTCAGA
TGAGTGCTTCCTGTCTTGTTAGCCCCCATGCTGGCTGCAAAACAATACGCCCAACAATGC
TTTTAGTTCTCTTTTGCTTTAATTAAAGGAAGCTTTTGACTCTGCTGCATTCACACTGTC
ACCTCCAACAAGGCTACAAACCTGTACTGAGCACCTCCTGTGTGCCAGACACTGGGCACA
CCAGGAGAATCAGATACAGCCCTAGCTTAAAGAACTGAATCACTGAAGAAATTAAACCCA
CAGGCAGTCTCGAAGTTATGCTTTCCAGCATTGGAAATTTCAAGTTTTACAAAATTTTAA
GGAGCTTTACAAGTAGAGGAGGGGAAATGGGACTTGCTTGTGCCTCGGCTGTGTACAACA
CAGGTGCTTTCTCGCACAGGGCTTGCTGAAGTGGAAGAACTAGCAAAGGATTTGGCACCA
GAAAAAAAATCCAGTTTCCACTTCTAGCTTCCCTGCAAGTGGAGGGCCTCTGGCCTTGGT
TTCCTTATTTGCAAACTGGAGCTCAAAGTTATCCCGAACTCCCCAGAGTTGTCCTGAGGA
ACCCGAGAAGTAAAGCAGGAGAACCCTTTATTGCGCACAAGAATTAAAAAAGCGCACATG
GTAAGGACAGGATAGACATTTGCTGTATTAAGACCACGCGTGTGTCCCCAGACCTGGTTC
TCTCCCTATGTCTGCTTTCATAAACACTGGTGATCAAACAGTTTTTAAAATTTAGAAAAA
GAAAGAGAGAGAGAAAGGAGAGAGGGGGAGAGAATGAGCATGTCAACCACGCGGCCAGGG
CTCTCAGTCCCAGCCCTCCCTGCAGGCACTCCAGAGGCTCACCAGCGTCAGGCCTCTCAG
AAACCTGCCACGTTACGTGCTATCAGCCTCACGTTCCAGCTGAGAGTTAAGTTGTTCAAT
CACTGCCACTTGGCCGAGGCAGGGTGTGAAGTCACAGTGGGTAGCACGAGACTTCCTGCC
AATGCACCACAAGGCTTTCTCCTTCTCCAACTGCAGGCTCTTGGCTCCCACCAGCTTTGG
GTAATGAGTCCTCGTTCCCACCCACAGTCTACAAATCCGACTCTCCACTCCCTCATCAGC
TCCTCCCTGTCGGCTGCATTTGTCACCAGGATTCTATAACCACCAAAGCATTTGGCTAAA
TGTGTTCTGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGTCCTCAAACGAT
GCTCCTACCCCCAGAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved