Oryctolagus_cuniculus Locus Poly:27:SNORA63
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:27:SNORA63
Oryctolagus_cuniculus
Poly:27:SNORA63
GeneScaffold_2781
SNORA63, SNORA63
1001..1132, 1352..1472
2472
AAGGATAACATATTAAGTTGTTCATCAACAGTCAGGGCGAGGGCTGATCAAGCCACGGT
TTCTCATAGTGTTCATTTCACTTTAACAGGTTTCCTTTTTGGTGCTCAGTTAGTTGTCAC
CTATCAGGGAGAACATGTGGTATTTGTCCCTTTGGGATTGGCTTATTTCACTCAGCATAA
TGTTTTCCAAATTCCTAACAGGGATCACTTTTCAGTTAAAATTTAAACACCTAAGAATAA
TTGTGTGTTAATTACAGAGTTCAACCAATGGTACTAGAACAAAAAAAATACTAAAATGGA
TAAAGTATTACATTGTACATCAACCGTCAGGACAAGAGCTGATCAAGTCACTGTTTCTCA
TAGTGTCCATTTCATTTCAACAAGTTTCCCCTTTGGTGCTCAGTTAGTTGTCGCCAGAGT
CTTAGGCCTCACTGTAACCACTGATCCTTCTCCTTCCTTTTCCTTCACATCCAACTGCTG
TAAATCAGCAGCCTACAAATGGACAACCCATTTAAAGCAGGGACAAGACAATGTTAAAGA
TGGAGCCGGCAGCAGTAGAATACTTGCCTCTAATTTTTTTTCTTTCCCGCTTCAGTCTGC
TGCTATTTCCTAATTCAGTCCTTAGCATCTCACACTTAGACCATTGCAATGATCTAATTA
GTCTTTGTTTCAAGTCTCAACTTCTGCTACACCCTGAAACCATCTCTTCACTATCAGATT
TATTTTCCTTGCACTCTATGATAATTTGTCTTTCTTGCTTAAAATTCTGCTTGTCCTTGC
TTGTCAAGTGGCTTTTCACGGCTTTCAAAGATGAAGTCCATACTCCTTGGCGTGGCTTCT
AAGGTATTCTATATCTGTCCATAAACAACTTTCTAAATAGATTTCATGATTCTCCCATAA
GAATCAAATGAATCTAATCAATATTTCTAAAATATACTCTGCATATTTCCTTGCTTGTAC
CTTTGCTTCTGTTGTTTATTCTGTTAGAAATGTTATTTGTCAGGTAGGATTCAGATTACA
AAATAGATGTTTCGTGCTGTGTTGTCATAACCTTTGCTTAAAATAAAATTTTTTCTTTCT
TTCTTTTTTTAAAGATTTATTTATTTATTTGAAAGTCAGATTTACACACACACAGAGAGA
GAGAGGTCTTCCATTCACTGGTTCATTCCCCAATTAGCCCCAACAGCTGGAGCTGCACAG
ATCCATAGCCAGGAGCCAGGAGTTTCTTCTGGGTCTCCTACATGGGTACAGGGGCCCAAT
GTCTTGGGCCATCTTCTGCTGCTTTCCCAGGCCATAACAGAGAGCTGGATCAGAAGTGGA
GCAGCTGGGACTTGAACTGGCACCCAAATGGGATGCCGGCACTGCAGACAGTGGCTTTAC
CCGCTAAGCCACAGTGCTGTCCCCAGGTTGTTTCTTAACTATACCTGTCTGCTATACACC
CTGTAGCAGCCAGGGATGCTTGGTCTCATATATGTTTTAAAAAAAGTTATTCATCTTTTT
TCTGCTAACTTAATTATTATCTGTCCTCTGGTGCAATTCCAGAGTTGAATAGAATGCTTG
GCATAATAATGATTTGTTCAATGAATGTGTGGACTCAAGTGTCATTTTACTTAGGAATTT
CTCCTTCTTACATGATCTCATAATGATTTCCCCCCTTTTACGGTTTTTATAGCACTGATT
ATTTCTACAAAAAATTTCACAATTGGTGAATTTTCCTCATATTATTTAACTTAAAAATGA
CTTTCTAACCAACTGCATTCTTAACTCTTTTTGGGCAAGTATTCTGTCTTTTACATTTTG
CATGTCTCAGTCAAGTTAAGAATTGTGTATGTAGCTGACAAGCAGAGGGATCTTCAAAAC
CTTCATGGAAAATGAGTATTATGAAAATACTACTCATGGACTATAAATTTATCTTTGCAC
CAAAATAAATTCATACAGAATTGCTATAATATATATGAAAAGAATTTATTTGGGGTCTTA
TGAAGGGTAAGAAATCAACTTGAAAAGCATCCTTATCAAAACAACATTAATTATGCTCAA
ATTGAAGAAAGAACAAGCATCAAGTCAATGGCAAAGCTTGGGCAGAAGGATGGTGAACTC
TTTGGTGCTTTATGAAAAGTTTAGTTTACCAATGGAGAACTCATTTTAAGAAGAGCCAAG
ATTATGTGAAAATTAAGCCCACAGCAGCAGACCATTTGCACCAATTTGCAGAGAAAAAGA
AATCTCGTGCATGCACTAAGTGAAAAAGACTGACAATTTGCAGCAGAAACAATAGCCAAC
ACTACAGACATCTTAATTGCTTCAGCTAATGCAATTCTGACTGAAAAATAAAAACGGAAC
GAATTTTAGGTATCTATTCAGTCTTCATAGTGGAATCAGATGCTATTAATATCTTTTTTA
ACTTTTATTTAATAAATATAAATTTCCAAAGTACAGTTTATGGATTACAATGGCTCCCCC
CCATAACTTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved