Oryctolagus_cuniculus Locus Mono:122:SNORA46
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:122:SNORA46
Oryctolagus_cuniculus
Mono:122:SNORA46
scaffold_141722
SNORA46
1001..1140
1956
TTCTTCTCCATCTTCTCATTCTTTCTTCTTTTTAGCTGCTTCCTCATTCCTTTGTCCCT
CTCCACCCCTTTCCAAGCCCCGCCTGTCCTCACGTGGAGTTAAGGAGATCAGGTTTCAAA
TCTCACCTTTACCATTTACCAGCTGCCTGATGGGTGCAAGCCACTTTACTTTTTGGGCCT
CAGTTTCCTTATCTGCAAATAGCAACAGTCGTCTCTTTGCCGTTGGGCACTTGTGAAAGT
GGAGTTAACGCGGAGGCACATTCTGGCATGTGGAAGGCAGTCTGCCTCCTCTCCCATCTT
GCCCTGTATTTCATTTCCACAGCTGCACTGTCTTCTTCGCCTTCCTCTTTTTAAATAATG
CTACTTAATTTAAGGACAACACTTGACTTAATAAGGACCTTCTTTAGCTTTTCTTTCTTT
CTTTCATTCTTTCTTTCCTTTTTTTTTTTTTTTTTTGTTGTTGTTGTTGTTGACAGGCAG
AGTTAGACAGTGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTTTCCGTTGGTTCACCCTC
CAATGGCCGCTGCAGCCGGCGGACCGCGCTGATCCGAAGCCAGGAGCCAGGTGCTTTTCC
TGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCCTTCCCGGGC
CACAGCAGAGAGCTGGCCTGGAAGAGGAGCAACCGGGACAGAATCCGGCGCCCCAACCGG
GATTAGAACCCAGGGTGCCGGTGCCGCAGGTGGAGGATTAGCCTAGTGAGCTGTGGGGCT
GGCCAACTTTTCATTTTTTTTAAAGATTTATTTATTCAGCACTATATTTAAACCTACCGA
TGAGAATTTTCCTCATTCTTGGTTACGCTGTTAGTGCAAAAGAATGTCCGTGGCTCCGTC
AGTTGCATAGCTGACTTGGGCCATTCTGCTGTTGCTTAATGGAGTTAAGAACGTTGGAAA
AAAGAAAGATTAATTTATTTATCTGAAAGGCAGAATTACTGAGAGGTAGAGGCAGAAGCA
AAAAGGGAGAGGTCTTCCATCTGCTGGTTCACTCCCCAACTGGCCACAACGATTGGATTT
TTCCCTGATCTGAATCCAGGAGCTTCCTCTGGGTCTCCCAAGGACTTGCAGGGTGCAGAA
GCCCAAGGACTTGGACCATCCTCCACTGCTTTCCCAGGCCACAAGAGAGAGCTGGATCGG
AAGCAGAGCAGCCAGGACTTGAACTGGCACCCATATGGGATGCTGGTGCTTCAGGCCAGA
GCATTAACCCGCTGCACCACAGCGCCGGTGGCTTGATTCTTATCATGAAATGATGTTATA
TTTCATCAAATGCTTTCTCTTAATCTATTGAAATAATCGTATGATTTTATTCATTTTCTT
GTAAATGAGATATGCCAAATTTATTGATTTGTGCATGTTAAATCCACCCTGCCTTACTGG
GATAAATCACTCTTGGTCCAGGTTGATAATATTTTTGATGTGTTGTTGGAATTTATTTGC
TGGTCATTTGTTAAAGATTTTTGCACATTTGTTCATCAAAGATATTGATATGCAGTTCTC
TCTCTCTCTCTCTCTCTCTCTTTCTCTCTTTCTCTCTTTCTCTGTCTCTCTTCTCAGTCG
TGTCTTTATCTGCTTTTGGAATTAAGGTAATTCTGACTTCAAAAAATTAGTTTAGAAGGG
ATCCTTCCTTTCCAATTTTTTTGAATAATTTATGAAGATTTAGGATTAGTTATCCCTTAA
ATGTTAGTCCAATTCAACAGTGCATCCATCCAGTCTGGGGTTTTTCTTTGTGATGAGGCT
CTTCAGTACTGCTTCAGTCTCAGTCTTGATTATAAGTATACTCAGGTACTCAGGTTTTCT
ACATCTTTGTGCCTCAGTTTTGGCAAACTGTATGTGTCAAGAAATCTGTAATTTCTTCTA
GGTTTTCCTACTTTTTGTCAATAATTCCTAATTATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved