Oryctolagus_cuniculus Locus Mono:42:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:42:SNORD116
Oryctolagus_cuniculus
Mono:42:SNORD116
scaffold_187665
SNORD116
1001..1090
1402
TTTCTCAGTGTCCTGACATTTCAAAAGGTCACAGAAAATGAAAGAGTAAATGTATTATA
TTTCTGTGAGGATACAGTTGCATATTTCTCTGCTCAATTGTTTTAAGATCACTTATCCTC
ATAGACTGCATTTGATATAAATCAATTATGCACTGGTTATTTTTGGGGGGAAGAAAAGAG
ACACAAAAGTAAATGATCGGTCAAATTGAAATTACTTTCTGTGTTTGTATATGAAGTTAG
TAGTTTCAGGAGCAGTTTGATTTTCTCATGTTTATGATGTAACTATGTTTTAACTAAAAA
TTAGGTGATTTAAGAAGTCTCAAAATTCGCCAAGTTGATTCAAACTATTTATCATCATTT
TTGCAAAATCAATATAGTATTACAATATTGGTTAGCGAATATCTCTTGTATAGAACTTGA
AATACAGATGAGAATAAAATGCATGAAGTAATAAAATGTCAGTTACTTTTAAGTCTCGGT
TGCTTACAGTTTTTACATAAGAACGGCTTCGTTCTGAGTCCTTTTTTGATTTTTCCTTTA
CTGCTGAAAATCTCTGTAAATTTTGTGCAATTTTTCTTTTTTTTTTAAAGATTTATTTAT
TTTATTTGAAAGGCAAAGTTACAAAGAGGCTGAGAGAGAGACAGAGAGAGAGAGAGCCCT
TCCATTTGCTGGTCCACTCCCCAGTGGCCGGAGCTATGCCAATCTGAAGTCAGGAGCCAG
CAGCTTCTTCCGGGTCTCCCACATGGGTGCAGGTGCCCAAAGACTTGGGCCATCTTCTAC
TGCTTTCCCAGGCCATACCAGAGACCTGGATCAGAAGTGGAGCAGCAGGGACTCGAACCG
GCACCCATATGGGATGCCAGCACTGCAGGCAGCAGCTTTACCCGCATGCCACAGCTCTGG
ATCCTCTGTGATTTTTTTTGTCTTTGAAAATTATTGATGTTGTCCAAGGTCAATAATAAT
AATAGACTAAATATTAAATGAGATTAATATGTAGAAGGTGGATTGATGGTGACTCCACCA
TAGTCACTGCTCAGAAAAGCTGAATAAAATGATTAAAAACTCATAACCGTCTTTCTCAGT
TTAACTGAGATGATGTCAAAGGCACGAGCCCTAGAGCTGCCTCCAGAAAATTTTAATGTG
AGTGCCATTCTGCAGCAATTCTAATTTTAGGTCATCAGTATCTCTGAGGATGTATTTCTC
CATGTTCAACATAACAGTCACACTGTCAAAATACCTAGTGAGTTATACTAATCCACCATA
TAACAAAACTTTTGTGTGTTATTGCTGGATAATATTGTGAATAACAGTTTTTCCTATGAA
ATTTAAGCTGCATAATATAATTATAAATATAAATCTGAGAGTGGTGTTTTTATAAGAGAT
GAGAATATTATAAATCAATTATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved