Oryctolagus_cuniculus Locus Mono:90:SNORD14
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:90:SNORD14
Oryctolagus_cuniculus
Mono:90:SNORD14
scaffold_132586
SNORD14
1001..1085
2085
CTTCCTGGGGTCGTGGCTTCTTGCCTCTCTGCATGGCTGCGGGACATCCGCGGTGAGCG
GGCCGTCCGGCGCCGCAGCACTTTCAAAAGCTTCTCCTGGTTTAAAATAGGGATCCTCCA
GAGCGAGCTTTTCCTTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCTGCGAGAGCTATGTAGAATCTCTGAAACGTTAGAAAAAAGAAAGAGAAGATAGTAGCT
TTCTTCCGAAGCTAGTTTTCTCCGGCAGGACTCCATCCATCTTCTCACAACTCCCATTTT
TCTCCTCTTCACCTTCCGGCAAGCGTGGGGTCGTGGTAAATGACACTTCTGATGACTGGG
AAAGCAGCAAGCGAGCTCCTGGTGCCGGCAGTGGGGCTGCAACCCCACACCACAGGGGCC
GCGAATGGCGGGTCTTTGACAACAGGACTTGTTGGGGACACAGCAACCCCTTCATTGTCA
AAGCTGTCCCCAGGGATGATCTCACCGTCAAAGACCGAGACCATCTGAGCAAACATCGAG
TCTGTAACTCCCTGACGATGCACTTGGCCAAACAGCCCCAGAGCTCTGCTTTACAAGCTC
ATTTGGTAAAAAGACTCCTTCACTGGTCTTTCCGGTCAAAGATAGATTTTAAGGTTCAAA
AATTGCCACTAAGGGTATACTTTTTACACTGCAAAATAAAGCCCATACTCCCATTTTAGT
GACAAGAAAACAAAGGATTGAAAATAAATGGGAAAGAGCTTTGAGATGATGTAGAATTCT
AAGAGGTTTCTGTTGTACAGTTGGAATCGAGAAAGAGCTTCCACCCCATGTCAAAGAGGT
CAGGTGCGTATTCGGACCACTGTAGCAAACTGCCTGGGTAACCTGCAGGCCATAGAGGTT
CATGGCTCTGGAGACCGGGCAAGACCAAGATCAAGACGCCAGCAGCGTGATGATGGATTC
CAAAACCATTCGTAGTTTCCACAAGAATTCATGTGTTGGAAGTTCCTTCCTTGGATGTCT
GAGTGATTAAAAAAAAAAAAATGCCAGCAGCAGCTTCAGTGAGCGCGAGGGCCTATGCCT
CGTCGGAGGAGAGTTTCACATGCCCTCACAGGGTGGAAGTCAAGAACAGCCTCCTCCCAC
CTGGGTTAGGAGGCCACCAATGCTGTCCACGAGGGCTCCTTCTGTTAGGTAGGAAGTCAG
ATATGAGCTTATGTGTGTGTGACAAAGGCCTAAAGAGAAGACGTCTATGTTCTGCATCTG
CATCTCAAAGTCATCCCGATAATGTTTCAGGGGCAGCCCCGTGTTCGCATCCTGCCCTGC
CCCCTCCTGCCCGATAACCTGCCAGGTGGAGGTCCCCTCCCCTTCTCCCTGACAATCTTC
CACAATCTCCCAGATGCAGCCCAGTATCTGCATTTCAAACACCCTGCTCTGGATCCTGGG
TTAGGACGCCAGCGAGGCTTCCTCCTGTCTGATACCTTCAGGGGAAAACTCAGATAGGAG
CTTCTTAATATTTACATCCATAAAATCCTTTGTTTCGGGAGGAGATGTGTGAAGACAAAG
ACCCATCTCCTTAAAAACCCCTGGCTTTAACTGCACTGGGCGCTTAGCCCTCTGCCTCTC
TGCTGAGCCGCCCGCCTGGCCTGCCCAGGTGTACTCTCTCCACTCTACCATGTAACCTGG
CTCTCCCCCAGACCGAGCGACTGGGCGCTCTCTCTCAGGTCCTGTCTGGAGAGGTGCCCG
TCCGTTCTTACAGATGTCCCTGCCCTAATAAACCTTGCTGTTTTACTTTCCACTACTCTC
TGTCTCACGCCTGAATTCTTTCTTGCGTGAAGACAAGAACCCTGCCATTCACCAGTAACA
CCTCCTCATGATCCGGTCATTTACCAGGGCTCCCACCTCTTCATACGTAGGGGATTATAT
TTCTTTTTTTTTTTTTTCACTTGGAAAATGGTTTAATGATGTTTTACAACAGAAATGAAC
CGTACAGTTACAGTCAGTTTAATATATATATATATAAAATTACAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved