Oryctolagus_cuniculus Locus Mono:185:SNORA1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:185:SNORA1
Oryctolagus_cuniculus
Mono:185:SNORA1
GeneScaffold_3972
SNORA1
1001..1134
2134
GGTTAACAATATTGTATCAAGGTTAATTTCTATGTTTTCGACATCTTCCTATGACTTTA
ATCTATGAAAGATAGGAACATAACAAGCCATCAGGTCATGGGCATGCAGAAACTCTGCAT
CCAATTTTGCAACTCATAAATCTAAACTTATCTCAAAATAAAAAGCTAGAAATATGCATT
GTCCTAAGTTTTATTCATTGAAAAAGACCTGAAAAAGCCATTACATCCCTTTAAGAATAA
GCAGACTTAACGGCCACTCGCTTCCTGTATCCAACTGCCAGTCCTGCCTCTCCTTCCCCT
CCAGCTTCCTGCTAACGTGCGCCTTGGGAGGCAGCAGATGACTCTAGTACTTCAACCCCT
GCCACTCACATGGGAGACCTGGGTGACTGCAGGCATTCAAGGAATGAATCAGCAGACAGA
AGTCCGTCCATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCCCGCTCTCCTGCC
CCGACTCCTCTTTCCCTAGCGATCCATTCCTCCCTGTCACTCTGCCTTTCAAATAAAAGT
AAATAAAATTTTCTTAAAAAATAGGACTCATTTACACAATAACCTATTCCAGGTATGGGA
CAAGAAATACATGCAATGAACCTGAACTTGGAACTCTCCAGAGAAAGCGATTAGGAGGCT
GGGGGGGTCCCAAGACCTACAGGATGCATTAGCGAGCTGACAAGCCAATGTTTTAGTTCC
AGTCTGAGTCTGAAGACCTGAAAGGCAGTAGAATTGATAGTGCCACAGCAGCAGGCAGGA
AGGATTCTCTTATCCAGGATGCAGGCCAGCCTTTTTGTTCTTTTCAGGCCTTCAACTGAC
TGGATGACACCCACCCACATCACCCACATCACCCAAGTGGGCAATCCGCTCTATGCAGCA
GACTAACCTCAAACACCTGCACCGGAACACCTAGAATAATGTTAGATCCAACACCTGGGT
GCCCCATGGTCCAGTCAAATTCACAGAAATTAACTATCATGGGCCTCATTCTAGATGAGA
ATGGGCACTGGTGACTGTGGTATCCAAAATTATCATTATGGCTAAACTGAGACACAGGTC
ATGCTTCTATCACAGTAAACGAACTGCAGTGGTGACAAGAAGACCTCTAACATTTAAAAA
AAAAAAAAAAGGAAAAAATCATGAATGTAGAACACTTTGTTCTGACAGAAGACAAGGGAA
GTATCAAAGGTTAAAGAAGGCTTGGGGCCAGTGCTGAGGCACAGGTTAACGCCCTGGCCT
GAAGCGGTGGCATCCCATGTGGGCACCTGTTTGAGACCCAGCTGCTCTACTTCCTATCCA
ACTCTGTGCTGTGGCCTGGGAAAGCAGAAGATGGCCCAAGTCCTTGGGCCCCTGTACCCA
CATGGGAGACCCGGAGGAAGCCTTAATGTTAGCATATAATGATCTCTGAATATTTAAAGA
TATTTTTAAAGAGAAAAAGTAAAATTAAATAAATTTTAAATAACAAAAAGATGATGGACA
CAAATGGAAGTAGCCAAGGTACCACCTTTTCACTCTGAAAATAACTATTTCTCTTTCTAC
TCTGAAAAAATAACTCTAGTTGAGGAAAGGTTCTCTACAAAGGAGTTTTAGCTATTAAAT
GTGAAAGGAACAAAAATTAGAAAATCCATGTTTGCAACCTCTAATGAGTGAAAAAAATCT
TTTCTAAAATAACAGAAAAGGCCGGCGGCGTGGCTCCCTAGGCAAATCCTCCGCCTTGTG
GCGCCGGCACACCGGGTTCTAGTCCTGGTTGGGGCGCCGGATTCTGTCCCGGTTGCCCCT
CTTGCAGGCCAGCTCTGCTGTGGCCAGGGAGTGCAGTAGAGGATGGCCCAGGTGCTTGGG
CCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGCTCCTGCCTTCGGATCAGCGCGGT
GCGCCAGCCGCAGCATGCCGGTCGCGGCATGCCGGTCACGGCGGTCACTGGAGGGTGAAC
CAACGGCAAAAGGAAGACCTTTCTCTCTGTCTCTCTCACTGTCCACTCTGCCTGTCAAAA
AATAAAAAAATAAAATAACAGAAAAAAGTTTGATGGTAACTGCAGAATGCAGGAAACAAT
CTGTCTCCCTAAACCTACCAAACAACACTGGCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved