Oryctolagus_cuniculus Locus mono: SCARNA9
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus mono: SCARNA9
Oryctolagus_cuniculus
mono: SCARNA9
scaffold_215179
SCARNA9, snoU2-30
974..1348, 1279..1348
2348
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTAGTAGG
CATTATTTAAGCACTCTAGAGATGATTCAAGGCATACAGGAGGATATGCATAGGTTATAT
GCAAAGCCTATGCTGTTTCATGTAAGGGACTTGACATCCTCGGACTTCAGTATCCACAGA
GGGTCTTGAAACCAATCCCCCACAGATACCAAAAGACAACTGTATGTGGTTTCTGCTTGT
ATTAGGTGATTGGGAGCGGGTTCAAAGAAACAGGGCTTTGCTGTGTAGTACTGGGTATTG
TCGGGAAGCAGGGGTAACTCAATTGAGTACCTAAAAATTTTTATCTAGGTGGTGGGAGGA
CTGGAATAGGTGAAGCAGCAGCAGTCACTCACGTTAACAAGGATAAGGGGATGCTTGGTC
GTTTTTGTGGCTTGGGTAATATTCATGGTTTTCTCCATGTTCCGGCATAGCTACAAGAGG
TCTTACTTTCGTCCTTGTGCGTTGTGATCATGGAGTAGCTTTATCTGCTATTGGCACTCC
GCCAGGTATTCAACGGAATGCCAAGGCCTTGCTGATAGTGCCAGGTTAGTCCCTGACCCT
CAGAGCCTGGTTTCTATTATAGAAAGGTCTTGTTTTCTGAATACTTCTCCATCCCCTTCC
TCCACATTATGCTGGTTCTCAGCACCTCACACTTTGAGTTTTAACTCCATAATCTTTTTT
AGTTCAGGTCAAGGAGTCCGAGGTAGAGAATCATGCAGTATTGAGTTTTGCTGTGGAAGA
AGAGTATCCCCGTTTGGGTCTAATCGTAAAGCCAGATGATAAGGTTAGTAATGTCTTGTT
GTATGCTAAGTTTTCAGAGCTGTTTGGTTTCATATTTTCTTTTGCTTGGCTTGCTGAAAT
TTTAAAGTCTGTGTTCTCTGAGATCTGCTCATACCAAGGTGGATCAATGATGAAAATAGC
CAAATCTGAGCATCAGAAGACCTTCTAGTCTTACCTGATGCATGATCTCCATTGTTCTGA
GAAGCAAAACTATCATTATTTAAAACAATATGAGCGTTACAACTGGGGTTTGTGTGTGTG
TATGTGTGTGAGTGTATGTATGTATGCATGTGTCTATAAAGATGGCAGTGGATAACTGAG
GACTAGATGGATGAAATGTGTGTGTGTGTGTGTGTGTGTGTGAGTGTGAAAGAGATGGAC
AGAGAGGCTAATCTTTTCTGAGCAATGATGAAAAGGTTTTACAACTGACCTTTATAACTA
TGAGGTTTTCTACACTTGACCTGAGCTCAGAATTGATAACTGCTGAGATTGGTAATTTGA
AATTTCTATAGACATTAGTTGCTACATTGTAGTCTAACAACACCTTAATTTTTTAGGCTG
AAACACAAGCGATTTCTCCTGAGCCAATATCCTCAGAAACTGTTTCTACTGGGAGCTTTT
TGAGTTATGAAAACATAGACTTGAACCTAACAGATCCAGGTAATAACAGCAGAGTATAGG
AGACAATTGAAAGACTAACACTATTTGAATTGCCACACAGTGGAGGCAGGAAGCATTGCT
TTTTTCCTAATTCATTTGGAGTGAGGGCTTAAGGGAGGGGAGTTGTACTATTTCTTTACA
TCTCCAAAGTGAAGTAGTATTGATGCCTCATGAAATATTGGACAGTCTAGTATTCAGAAC
ATGATTGGAAGCCACAGAGATGTTCTGTGTGTTCCCAGCAGCACTCTGAGTAGTATTCAT
AAATGCTACTTTTTCCCATTCAGTGGAAATCAACAGGAGCAAATTTCTCAGTTGTACTGT
CTCTTAACAAATATTTACTGTCATGCCTTTCTAACAAAATATGTCTCTAAGGAAATACTA
TGCCATTGAAAAGACCGTAGTGTCAGTGTCAATTAAATATTTTTATTAAACTCAATTTTC
AGAGCACATGGACTATAGGAAACAAGAGTCTACCACTGGTAAAGAAGAGAAAACAGGTAT
TTTAAGTTCTATACCTCCTTCAATGTAAGTCATTTCTCAGCAACAGAACCCTTCTGGCAT
TCATAAATCTAATGCCTATGATGGAAGAATTTACATCTGATCACACACACTTTCAGCAGA
TCATACACAAGTACATAAATGAAACAAATTTGATACCTAAAAAAACCTACTTGTGGAGTA
CAGTTATTTTAAAGAAATTATTTTATATAAATTGTTTATCTTTTTGATTTTCATCCTTTT
AATTTCAATTTTTATTTCATTTATTTGAGATAAATAGAGCTCCAATATGCTGGTTCACTT
GGAACAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved