Oryctolagus_cuniculus Locus Mono:182:SNORD88
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:182:SNORD88
Oryctolagus_cuniculus
Mono:182:SNORD88
GeneScaffold_1972
SNORD88
1001..1091
2091
CCAGTCCTGGCTGCTCCATTTCCAGTCCAGCTCCCTGCTGATGCACCTGGGAAAACAGC
AGAAGATGGCCCAAGTATTTGGGCCCCTGCACTCACTTGGGAGACCTGGAAAAAGCTCCT
GGCTTTGTCCTGGCCCACCCAGCCATGGTGGCTATTTGGGGAGTGAACTGGCAGAGGGAA
AAGCTCTCTCACTCTCTCTCTCTTTCTCTCTTTCTCTGTCACTCTGCCTTTCAAATAAAC
AAAATAAATCTTTAGTAAGGGATCACTAGAGCCAACAACCTGCCCCTGCCTCATCCCCAC
CCCCAGCACTGTCTCAGAGAAAACTAGAATGCACTTGCCATATTTTAATTTTATTTATTT
ATTTGAGAGGCAAAGAGACACATAGAGACATACAGGAGAGATCTCCCATTTGCTGATTCA
TTCCCCAAATGCCTATGACAGCTGAAACTGGACTGAGTTGAAACCAAGAGCCAGGAACTC
CATCCCAGTCTCCCACGTGGGTGGCAGGACCTAAGCACTTGAGCCACCTCCACCTGCTGC
CTCCCAAGGTGGGCACTAGTGGGAAGCTGGAAGGGAGTGGAGCTAGGACTCAAGACCAGG
TACTCTGAGACGGAACGCAGGTGTCCTAACCACTAGGCCAACGCCCGCCCCGCCACGTTT
CGTGTGCTTGTTTTGTTTTAGCAGTTTTAAGTGAAAGTTGTCTCTAAGATTACTTTATTC
CGCCATCTTCCTGAGTGCTGCTTCCTCACATTTGCCCTTCCCCTGTCAGACTTGGTGAGA
CCTGGCTTTGCGTTCCAGGATCCTTTTACGTGCTGTGCAAAGAGCGTGCTTTCAAGCTGA
GAGGCCGCCCTCTGCCAGCACCATCCCGGTGATTCCGCCAGGGCCACCTCTGCCACCTGT
CCAGGTAAGAACAAAAGAGGCTGCCTCCCGGTGGCCCTGTGCCGCAGGGCAGGGGAGGGG
TGGCTTCCTCCTGGGCCGGGTTCCTGAGAGGCTGCACCTGGGGACCTGTTTGACATCCAG
CGCTGGGCTCTGACCACTCCTGAAGACACTGTGCTCCCTGGGACCTGTGACACTCAGAGG
TCGGAGGGGGATAGAAAGGAAAAAAAAAGGATCTTTTTTGTGGTGTTTGTCCAGTTTCAA
GCCAGCAGGAACCACCCTGTTGGATGACTGCCACAAGGACAGGTGTGCCTGTGGCCTCTT
CCGCCGCACCTGTTCAGTGTGGATGGCAGATTTTTTCCAGTAGCCCCGGGCCATGCTGCC
CATCTGCCGGCCCTCACGGTGTCCTCGCACCTCTCGCACTGCGCCTCCTTTCACACGGGC
ATGGAGCACACCTTGAACTTCTGTCTCAGCTCTCCCGGACGGGGGAGACTCGGCCTTCCT
GCATTGCAATGCCTCCTTCAGCCACAGAAGGGTTGAGCTTCATCTCAGCCACAAATGGGA
AAAGCCCCTGCCACATTTTTAAAGAAAACAATGAAAAATTACAGTTGCTTTATAATTTAG
TGGGAAATGCATATTCTTTTTAAAAGATTTATTTATTTACTTGAAAAGCAGAGTATGTGT
GTGTGAGAGAGAGACTGTCCATCCGCTGGTTCACTCCCCAAATGTCCCCCACAGCCAGAG
CTGTGGTGATCCGAAGCCAGGAGCCAGGAGCCTCCTCCGGGTCTCCCATGTGGGTACAGG
AGCCCTAGGACTTGGGCCATCCTCTGCTGCTTTCCCAGGCCATAGCAGAGAGATGGACTG
GAAGTGGAGCAGCCAGGACTCAAACCGGTGCCCATGCGGGATGCCACAGGCGACAGCTTT
ACCTACTATGCCAAAGCACCAGCCCTGAATTCTCTATTTAATTAAATGACCCTTCTTACT
GGCCACTGACACAGTGACCTGTGCCATGACTGGCTGCCTCTTCACACGCTGAGGGCTGCC
GGCTCCCAGTCTCACCGCAGGCCCTGCAAAATCGCTGGGCTTAAGTCTCACCCCTCCCAC
CTGCTGTGTCTCCCTCTCCGAATCTCGGCTCTGCTTGCGGTCTGTAAGAGGGGAATGAGG
ATTGCAGCCTTGGCGTGTTGCTCTTGGACTGCAGAGTGGGGAGAGGCCTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved