Oryctolagus_cuniculus Locus Poly:14:SNORD115
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:14:SNORD115
Oryctolagus_cuniculus
Poly:14:SNORD115
scaffold_124619
SNORD115, SNORD115, SNORD115
1001..1081, 2823..2903, 3614..3694
4694
TCACTTGGGTGGTGGTTAAGCTGGAGCCTAGGCTACACTATTGCTCTGGCTGATACCTG
GTAGGGGGATCCCAACCAGGTATTCCCTAGAAAACTGTGCCAGGCAAGTAACATGCCACT
GAGTGCCTCAACCACGGATGGCTGCTCAAGGGCCACATGAGTGCACCTCACCCTCAGTTG
AGTGCCTCAAGGATGCCAGAGACCCTCCTGGGCATGGGCTTCTTCTCCATGGGAGTCTCC
AAGTCCCCAGGGGAGGACTGCACCATGGTACAGCCCCATGACTGCACCATCTTTGGGATT
TGTATGTGAATCCAGGGGACAGTGACCACAGCAGGAATGTATCTCCAAGTGGTAGAGAAT
GAGCTTCCAGGATGCAGTCTGTGCATGCAGCCTGGCCCTCAGCACCCTGGCCTGGACTGG
GATGCCATGTTTCTAGGGCTAGGACCAAAAGAGGGCCTCCTTGAGTGTGTCTCACATGAT
CAGTTTTCAAACGCCAAGGCTGTGCCAGTGCTTGCTTGTCCAGCCCAGGTACTGGCCTGG
ACCTGGGTCACTGGGGCAGGATGGAGCATTGGGGGAAGCCACATCTCTCAGTGAGACCCA
TCCTATGTGTCCCTCTTGGTCCAGTTACCAACAGGTCCAGCCATCCACACGTGATGTGGG
AGAAGCTTGTCAAAATGCCACGCCTAGAGGGTGGGCTCCTAGGAATTGAAACTGGGCTGG
TAGGGCCAAAGCGTGCATTGGAACCAGTGTACTCTACTGTTCCTACTGTCTGTTCACAGT
TGTCACCTTCCCTGTCTATATATGATGTCACCAAATGATGCCCCTGTGAGTTTCACTACC
AGGGTGGAAAGGGCTGTGATTGAGGCCCAAGCAGCCCATGAGCTGGAAGTGTCATCCCTG
TTGGAGTAGGAAACATCCATGACTTCCAATGGTAAACTAATCCATGAAGGTCCTGAATTT
TGGTTGGTGAAGGGATGTCCTTTGTAGTGGTTCCTGAGGTTGGGTCGATGATGAGACCTC
ATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACCCTGAGGC
CCAGCTAGTGACAATGGTGTAAGAAGACCCTGGGATAACCAGGTGTTTTTAGGGGAGTAG
ACTCTGGGGACTGGCCACTTCCTGGCTTCACTGGTCAAGACATACTCCATAGACAGAAAC
TCCTTATGTCGGATGCACCAAGTTTCTTCTTCCTTAGGCTTGGTTTGTGCTGTCAGTTGC
AGAGCCATGCTGGGGGCTCCTTCCTCAGCTCCTTTCTTCCCCTTCTGTCTTTCAGTGAGT
AGAGCAGCCTGGTGGGGCAACCTTTCAACAGACTTCACAGGTGAGTGGATGGTTGTAGTT
AAAGGGCCTTTGAAGGGTTGCAGGAATTCTGGGTGGGTCACCTGTCACACCTGAGGTGTG
GACCCATGGAAACACAGGAGGGCAGCCTCAAGCACTGCTACTTATTTAGCTCTGCACTTT
GTGTTCTGATGTCCCAGAATACTTAGCTGAACCTCTACTGGTGTGGGGCCAAGCAAGAAA
TGCAAACATTTCCTGAGGGAACATTCATGTTGCCTCAGTGCTGCCACTTGGTCTGGGTGG
GCTGCACTGGCTCTGAGATGCCTTGCTGGATTGGTAAGAATTGGGTGGTCACTGGGGATC
TGTCTTCTGAGTGGGGGCACTTTTTAGGTTTGGTTGGAGGTCTCATGAGGACAATCAGAA
GGAAAGAGGGACATTGGAGGGGTAGCCAGGTTTGCAGGTGCCTGACAGCCTGGAGCTTCA
GTGTGTTGCCTGGCTACTGGTGTGTACAACACAGGGACACTCAGGCTGGTGCCCAGTCAG
GGGTTTGCTGACACATAGGTCCTGGTATCTGTGGGGTGCTTCCAGGAATGAGCCATCCTA
CTTCTTGACTCATCCATGGGCTGGCATGTGGGTCACATGGGTGGGCAGCTGACTGTGTTG
AGCCCAGCTAGAATGCAAGGACCCCTCCTGGACCCTTATTTCGTCTGCTCCATGATAAGC
AGCAAGGCCTTATGTTAGAGGTAGGCGATAGTCCAGACCTCCGCCTGTAGTTCAACATAT
ACAGGACTAAGGTAGACTGGAACCACAGGAGGAAGATGTCTCCAGTGAACACAGCTAGAC
TGGGGGAATCTAGTGTGTGCATGCAGACTAGACCTGAATGCCTGGGCGTGTGCAGTGGTG
ACTTGTTATTAGGCCCTGGACCCCACCACCGGCTCCCTTGGTGTATCTCATGTGACTAAT
CCTTTGAGCGCAATTCTGTGCCAGTACATATGGTTGCACCACCCAGGTCCTGGCTAAAGC
CTGAGAATCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGACCACACTCACATGACTGGCTCTGAAAGCTCACTTGGCTCTACATGTCCATAGCATGT
CGTAGTAACGTGCACTTAGTCTGTCCTGCTGTCTGTTCACACCCACCCCATCCTCTTCCA
CAGATGAAGTCACGAAAAGAAGCCCCTGTGTGGTTCAGTGCCTCAGGGACAAGTGCTGTA
TCAAAGCCTCAGTGGACCGTGAGCTGCTGGTGCCAGCCCCCTGGACCGCCCCAGGTAAGC
CAATCCATCTGGGTCCTGAAGTAGATGGCTCCAAAGGCTTCCCATGCTGTGGTTCCTGTG
GCTGGGTCGATGATGAGACCTCATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATG
CTCAATAGGATTACGCTGAGGCCCAGCCTAGTGACAGTGGTGCAAGAGGATCTTGGGGTA
ACCATGTGCCTTTCAGGGGAGGAGAACCTGGGACCTTCAGGCTCTCCAGAACATGGTCCC
AGGCAACGCTGCTGCTTCTACATGATTTGAAAAAGCTCTTTCCTCCTTGAGCTTGGTGTG
TGCTCTCTGCTTTCCAAGTTGCAGCTACACTGGGGCTCCTTCCTCAGGTCCTTGATCCCT
TTCTGTCTTTCAGAAAGATGAACTGCCTGGTGGGGCATCCTTCAAAAAGTGTTCTAGGTG
AGTGGACAGAGGGTGTCATTTGGGTTTGTGTGAGGTAACAGGGGTCTGGCGGGTAACCCC
CAGGAGCCTGAGGAGTGAACCTATGGCCATGCTTCTGATTGATCTCCCCACATCTACAAG
GGTAGCCTCCTGAGAAGCCTCACTTAAGCTGAATGGGGAAAATGATTCTCTGGAGCAGCA
TACCAAGATCATGCCCCTGCTGTCTGTTTACAGCTGGTCCCCTCACCATGACAGATGATG
TCTGCTGAGGAAGTCCCTGTGGGTTCCAGTGCTCATGGGGTAAGGGCTGTGGTCAAGTCC
CTAGCAGCCCATGAGCTGGTGCTGCCAACTTCACTGGTGAAGGAAATGTCACTGTCTACC
TGAGGTAAGCAATCCATCCAGATCCTACGGGTGGGATGGCACCAGGGGTTTCCCATGGTG
TGGTTCTTAGGGTTGGGTTGATGATGAGACCTCATACTGTCTCGAAGAGAGATGATGACT
TGAAAATCATGCTCAATAGGATTACGCTGAGGCTCAGCCTAGTGACAGCGAAGCAAGGGG
CTTTTCATGATTAAGTTCCTTCCAGGAGGAGATCGTGGGGACTGGAGACTGCAGCCCCCC
AGGTAATGATGTCATCCTCAGGCAGCAAAGGCTGCTGGTGCAGGATGTGCACAAGCTCTT
CCTCACGGTGTGTGTACTCCCTGCTGTATGATTTGCAGGGCTGCTCTAGGGGATCCTTCC
TCAGCTCCTTTCTGCCCCTTGTATCTTTTAGTGAGACGAGCTGCCAAGTGGGGCACCTTC
TCGCCTGTGGTGCTAGGTGAGTGGATGGAGGGTGTCACTGGGCATGTGTGAGGCTGCTGG
GTGTCTTGGCAGGTCACCTGTAGTAAGCCACAGGGATTGAGCATGAGTACTGAAAATGGT
TCCATAAAGAGGTATCACCTGAGGCCACTGCCATCCCTGGGCCTCTGTGGGCTTCAGCTG
CTCGAGCTGCTTACTGTTATAGGCAGCAGTGGGTGGACACTGGGAATCAGGCCACAGAGC
TGGACCACTGCTCAGATTCACTAGGTGACCCAAGCCATGGGCACAGTGCGGCAGCAAGGA
AAGTTTGGCAGGGTAACCGGCTCTGTATGTTCCAGGCCGTTCAGAGATTTATGTGGCTGG
TGTTGCCACTGGAGTCTAGGATATAGGGAAGTTCAGGTCAGTGCCCTATAATTGGGCTAA
TGACAAATGAGGTATGTAACTGTTAATGCTGCCAGCACCACACCCTGTCCTCACAACTTG
CCTCATCCAGGGGCTGGCATTCGCAGGGAGTGTGGGTGGGCCTCGGACTCATTTGAGGCT
AACAAAGATGATAGGGGCCCTCCAGGCCCTGGGTTCTAGTTCATTCTTTGAAAGCACTAA
AGCTCCATGAAAGAGTGGGCCTTGATCCAGCCCTCTGCCCATACCCCATCTTTGGGATGT
GTACAGTAGTCAGGTGGACAGTGACCTCTGGAGAAAGTTGTCTCCAGGGTTTACAACCTC
AGCTCCCGGGATGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved