Oryctolagus_cuniculus Locus Mono:160:SNORD95
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:160:SNORD95
Oryctolagus_cuniculus
Mono:160:SNORD95
scaffold_109140
SNORD95
1001..1068
2068
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGGAGCTGGTGTTCTGTCCAAACCAAATGGA
GACATACCGGTCCGATCACAAAACGGGAATTTCTGACTTCACAGCAGCGCCCTCCCTGTT
AGTTTCTGAAGCCCAACAGGTTTCTGCCACCCCTGAGGGGAGAGCTGGCCTGTCCTCAGC
GTGTCTGGCAGGCAGGGGGCGCTGCAACGCGGGGGAGCCAGCCCCGAGTCCGCCTGGATC
CTTAAGCTGACAGGACTGTAGCAGAAACACATCAATCATCACTGCCAAGAGCATGAGCGT
CTTTGAACAGAGGCAACGCCGCTCATAGAAAAAGTAGAGAGCGGGCGGTGATGAGCCCAA
CAAGCCATCTGAGTATCCATGCAGAAAAAGTAGAGCTCCAGTCAGACCGCCATAATGAGG
TGGGCTGGTGGTCAAAGCCTCATTTGCATCCATTTTCACTCATTATTATGTGGCATTAAG
GAAATTTTCTGCCAAGCTGAGTGACCTTGATATGTGATTTCTTGAGCTACTCTGGGTATA
TGCAGAGCATAAGAAGCAATGATTCCCAAAGAGCCAATCTAATATGACAATTTTCATCAG
TCACCAAAGGGAGATTATACCTTTTGTCCATTTCTCCAATTTTTTTTTCTCGTGTTACTA
TAAAAAAGAGAGAGCAAAAATAAGATCTATAACCTTCAACAGTGCCCTTGTAAAAGTTAG
AGGTGTGACATAGATGCTATCTTTCACTCATCTTCGCCACCAGTCAGCATATCTCAGCAG
CTGAGTGAAATGTACACCTGACCACGTTGTTCTCTGTAAATCCTGGAGGTTCTTTCTGGG
TAATTCATGTGAATCTGACTTGAGAACCCTGGGTGTTAGGTTGTAAGGCCCAAAGAGCAT
GCACCTAGGCCCTCAGATCCTGACTATTCCAACCTCCACCAATTTTGAGCTCATATCTGG
GAGCAGGGGTTGTGAGAGACTTGAAAATAAAATGCTGATTCTTGCCATTTACAAATCTTG
TTTGATAGGAGTGAAATACATTATCCAAATTTCATCCCAAAACATTTTTTGCCAAATTTT
ATGCTGAAACCACCCAAAAAAAATAAAAAAAGAAAAACAAAGATTAAAACAGAATTTAGG
GGCCAGCACTGTGGCACACTGGGTTAACGCCATGGCCTGAAGCGCTGGCATCCCAAATGG
GTGACAGTTTGAGTCCTGGCTGCTCCACTTCTGATCCAGCTCTCTGCTATGGCCTGGGAA
AGCAGTGGAAGATCGCCCAAGTCCTTGGGCCCCTGCACCCACGTGGGAGACCCAGAAGAA
GCTCCTGGCTCCTGGCTTCAGATCAGTGCAGCTCCAGCTGTTGCAACCAATTGGGGAGTG
AACCATCGTATGGAAGACCTCTCTCTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved