Oryctolagus_cuniculus Locus Mono:226:SNORD65
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:226:SNORD65
Oryctolagus_cuniculus
Mono:226:SNORD65
GeneScaffold_6304
SNORD65
1001..1074
1962
GACGATGCCCGTAGCCGTCTGAGCGCAGTCGCTGAAACCTCGGATTTAGTTGCATGCAT
GGGTAACTGCCTTAGCCCCTGACGCCTGTCTTCCCGTCTTTAGGTGGCGCCGAGAACCCA
AGGTAGGCGCAGCCTCCCAGCGTGAGGTAAGCCCTAGTGCGGGGCCTAGTGGTCGGCAGC
TCGGGGGCACTGGGTTGGGCATTTGCACGAGGCCATGGGTTATCCCGTAGTGGGTGCGGA
ACCTAGGGCGGCTGTGGAGCTCTGGGCAGCGGGGATCTTGCATAAGTGGGGTCTGATGGG
TCCCTAAGGCAGTTAGGGCTCGGCTGGGGCAGCCGCGGGGACTGCTGTGATGAGATCACT
CTTAGGAAGTGCCGTCAGAAGCGACAACTGACGAGAATGCTCCTGGCTGATTGCAGTCCC
CAAGTCTGCCGCTGGCCAGGGCCGAGCCCGGGCTGGCCTGTGACCTAACGTGGCGGCGTG
TTCACGTAGGTTCCACGCTACAGCACCAGCAAGCCGCCGAGGGCTGGAGCTGCAGCCCCG
CCCCTCCCCCCGTCACGCGGTAAGTGTATCTGCGGAGCCGTTAGTGGTTCGTGCTACTTG
ATGCTGGTGTTTGATTGGGTGAAATCCAGAGGGCTGGGTCCCGGGTGGGCTGGGGCAGCG
TGGCGCCCAGAGCCAGGGAGGGGAGCTGCCGTCTGGCCTCTTGGCTGCTGAGTGGGACAC
AGCTGTCCGGGAAAAGAAAACCTCGGGTTTGGGAAGAGGATGGAACTCGGTGGAGGGGAC
AGGTCCCCCAGAGCGGCAGGTCGAGGCTGCTGTCAGCGGGTCTGCTCCAGGCTCCGTGCT
GTCTTGTTTTGAGCGCGTGCCTTCTCTCCTCCCAGGCTTTGCAGCAGGGAACTCGGGGGC
TGGCAGTGGCTTCTGCTCCGCGCGAGAGGTGAGTACGCACAGTGTTGACCCTGCTTACTG
GCAGAATGGGGGAATGAGCAGCTAGTTCAAGAAAAGGATATCAATGATGAAATCACCGAA
AAATAGCTGGAATTACCGGCAGATTGTGTGGTGGTGAGCCCAAGGTCTTCTGAAGATATC
TTCCGTGTTGGGAGTGGCTGTTGGCTGCTGGAGCAGGAAGGGGGACTGAAATGTCGTTCT
CTGCAGGCTGTCCCGGGAGGATGCTGAGCCCAAGGACCGGCTGCCGCCAGCAGTGGAGAT
GCTGCACGCCTAGTGACTCGGGGGTGGTGTGAGGCCAGCACACAGGGCCGGTGTTGCTCC
TTGAGCTGCCTAACAGGGGTGCCTTCTGCACTTCAATAAACTTAGTGTGATAAACTGACT
GTGGTTACATTTTTCTCAAAACTCTAGAAGTCACCATTAACCAATGCCATAATAAAGGGG
GGTCATTGTTGTTGGTTCTTAAAAATGTGTATTTGAAGAAAAAGTTAGCTCTGATTACTG
CTATCAGGTATTAACAGTCCAGTTATTAGCACTCAAGCTTGTAAACTTTGGGTCAGCCTG
GGCTGCTCTCCCCCTCTTAGCCACTTGAGACTGAGGGCAAAAATTCCGAAGCATTTAAGG
CATCTACACAACCGGTTCCAATCCAATCCTGACTTGGCTGCAACACACCTTTCACAGCTC
TCTGCCCGTGAGTCCTCCCCACACTTGCCTACAGTGCTGCGGTTCACCCATTGAGAACCT
GTACTGCTGGTCTGGCCTGATGACAACTGGCTCCCAGTCCCCTGACCTGGCTCCCAGGGC
TTGGCCTGGGATTTGGGAGAGTGGGGGAGGGGCCGCTGGAGGGCAGATGCCCTTTGCTGA
GTTGGGTTCCAGGGAGGCCCCAGGTTATTCGCCTTCTCTGACTGCTGGGAACTGTGCTCA
AGGAATGGCTGGTTTGGGAAGGGATGCTGGGAGAAGGGCCCGCCTGGCAGGTCTGCCTGC
TTGGCAAGGACACAGGGCTCCCTGTGGAAGCCTTCCCCCTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved