Oryctolagus_cuniculus Locus Mono:246:SNORD22
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:246:SNORD22
Oryctolagus_cuniculus
Mono:246:SNORD22
GeneScaffold_2359
SNORD22
1001..1099
2099
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CCTATGGCTTCTGTTGTCCTCTCCCAGTGGAGTCAGGAACATTGATTTCCCAGCGTTGGT
GTGTAACCAGACATAATAGGCACACAGAATATTGCCAGCCATGGAAGTTCACTCAAGACT
TGAGTTTTTATTGGGGCTTCATTATAAAGTCATAAATGATTGGCTGACTGCCCATGTGAT
TGTTGTCAATCTCTACGTCCACCCAGATGCCATTACCCAAAGCCCCCACCTGAAACTATG
TGATTGGTCTTTCTGGTTTCTGCTCCAAGATATGGGCAGCCTCACCCATAAATCATACTA
TTAGACCATGCAGTGTGACCCATGGCTCCCAGGCAAACCAAGATACTTCTTTCAGGAATA
ACATTTCACAGGCTTCTGGAGTACTTCCCAGAAGCCAAGATCAAAGGTCAGACTGCTTTT
GGGACAAGGTTAAATTCTTTACTACGTACTCACGCATAGCCATAAACTCAAGGTGGCATG
AAGATCTAAAAATGAAACAAGTTAAAGAACCAGAATAAAATATGAGTAAAAGTTCTACAA
ATCCCGGGACATAGATGTCTGTCTACATATGTCATTAAGCCTATAAAGCCCGATGGAAAA
TATTAAGTACACAAAAATGAAAAACTTCTGAAATAACAGACACCAGAAATGAAATGAAAA
GATAATCAAAATTAGAGAATGCATTCACATGATGTTTAAGTCAACAAATTGACATAAAAA
GACAAGCAATGCATTAGATAGGGGTACACACTCCACAACAAACAGGAAATTAACAGAAGA
AATAAATATACTATTGAGGAAATATACTGTACATGTAGATTAGTACAAACGTGCAGGGGG
ATAGTTTGTTTAGAGTCATTAAAATGTAAAAATTGTAAATGACATTTTACCTGTATGAAT
ATGACTTACTGAAGTTGGTCACAAGCTCAGAAATGAGGGTATCCCAATGAGGAAACATTC
ACACATCTTACTTCCTGTCCTAGTCCCAGAGCCTGTAAAGGCGAACCCTTCTGAGTTCCA
GAAGGAGCTGTCTGAGGGTCAGTAGAGGATTTCTGTACACAAGAAAGGGAATAAAGAAAT
GAGGGCATGTGCATGCACTTGCACACAATCTTATTTGCAATAGTGATAAGCACTCTAAAT
ATCTAATCCACATAAATAGATGCTATGCCATAGCCTACAAACAACAAGGTAGATCTCTAC
AAACTGATGTGAAAAAAGACCCATTACATATTCATTAAATAAGTTAAGTTACAAAAGAAT
ATTTATAGCTTGATTTTGCTTTTGTATATAAAAAGTAGATAATTATCAGAGTATTTCAAA
CGATTTGTGGAAAAGTGGAATTAAAAGATAAACTTAATCCACTGTTGGTGGGAATGTAAA
CTGGTAAAATCACTTTGGAAGACAGTTTGGAGATATCTCAGGCATCTGAATAAAGTCCTA
CTACACCACCCAGCCATCCCACTCCTGAGAATTTACCCAAGGAAAATGAAATCAGCAAAT
AAAGGAGTTATCTGAGCCCTCATGTTTATTGCAGCTCACAACTTACAATAGCTAAGACAT
GGAATCAACCTAACTTCAGACTATCATCTGAAGTCTGAATAAAGAAATTATGGGATATGT
ACTCTATGGACTACTACACAGTGATTTAAAAAAATGAAATCCAGTCATTTGCGACAAAAT
GGATGCATCTGGAAAACATCATACTTAGTAAAATAAGCCAGTCCCAAAGGGACAAATACC
ATATATTCTCCCTGATCTATGATAACTAACAGAGCACCTAAAAGGAAACCTATAGAAGTG
AAATTGACACTTTGAGAAGCAATGTAACTTTGAGAAGCAATGAAGCTGTATAGTTATGCA
TACATTTCTACGGATTTAATTCTAAGGGTGCAGATAAAAACTTGCCATGGGGGCCTGGCG
CTGTGGCTCAATAGGCTAATCCTCTGCCTGCGGCGCTGGCACACTGGGTTCTATTCCTGG
TCGGGGCGCCGGTTCTGTCCCGGTTGCTCCTCTTCTAGTCCAGCTCTCTGCTGTGGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved