Oryctolagus_cuniculus Locus Mono:1:SNORD56
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:1:SNORD56
Oryctolagus_cuniculus
Mono:1:SNORD56
scaffold_203300
SNORD56
1001..1070
2070
TGCATGAAGTTTGTGTTCCTTAAATAAAAGGTTTCGGGGGGGGAGGTTGGAAGAAGGCC
ATTCTCCACTCCAGTAACTGCCCAATCTTTAAATAAATGTGTGTATACATATATATGTAT
ATATGTAATGAAATATACTGGTAAACACAATGAAAATACATATTATAAATATATGTTAAA
GATTTATTTATTTGAAAGTCAGAACTACACAGAGAGAGGAGACACAGAGAAAGAGAGAGA
GAGAGAGAAAGAGAAAGAGAGAGAGAGGTTTTCCATCCACTGGTTCACTCCCCAGTTGGC
TACAATGGCCGGAGATACACCAATCCAGTGCCAGAAGCCAGGAGCTTCCTCCAAGAGTGC
AGGGGCCCAAGGACTTGGGCCATCTTCTACTGCTTTCCCAGGCCAGAGCAGAGAGCTGAA
CTGGAAATAGAGCAGCCAGGACTCAAACTGGTACCCATATGGGAGATGTTGGCACTGCAG
GCAGTGGCTTGATCCGCTATGCCACAGTGCTAGCCCCATACTGTATTTTTAAAAACAGTT
GTTACAGGTCATAAGGAGAGATTAGTTACTGAGCATGAGGGAAATTTTTGGTAAGATGGA
AATATTCTAAATTGTGATAGTCATGACTATTGCATGATTGTATGCATTGACCAAAGCCCA
TCAAACTGTCTCAAAATTGGTGATTTTATTATATGTAAATTATATTTTAGCAAAATTAAT
TTAAAATTCTTCAAAGAGAAAATTTACTTGAGGGGGTCCTCAAAATGTTCATGGAAGATG
TGTGCTGTGAAAAAGCTATGCAAATTTCAATATTTTGCACCCAAATAAGCTCATTTTTAA
TTTCATATCCCATGACCTTTTTGAAGTCCCTGTCAGGTAGCTGATACACACATAAACTCC
ACCCATGCCTATATAGAGATTTTTTTTAATTAAGCTTCTACATACATGGCAAAATAAAGT
GTCATATTTGAAAAAGATACCAGTTTTAAGAATGATAAGCTCTACCATGATGGTATATTT
TTCTTCAACAGCAATTCTCCTAATGAATGATGAAGCTTTGGGTCTCAGTGAAGCAGAAGC
AGGAGAAGGAGAAGCAGCAGCAGCAAAAAAAAATAAAACAATGATGAGTTTTTGAGAAAA
TTTTAACCTGCTTGTCTGCTTCCTCCTTCAGTACAGCATAACACAGAACAATTTTGCACA
CAGAGGAGTATGATACCTAGCACACATCTTCATGTATACCAAGCATGCGTGAAATGAGTT
TCTTTGACACGCCACCCGAAAGCCCTTATTAACTGTAACTCCTGATGCAAACCATAGTGG
AAAAATATTCCATTTCTGAAAGGACAGAAATGAGATGATGGTTGAGAAAATGCTAACTCC
CTGCACACAGTCAGGTGTATTTTATCAGGTGGGTTGCATTTAACAATGTTTGATAAGAGA
TTTTCCATCTGTTCGTCTCACTGTCTCCTAGAGAAAACACAAAGCCTTGAAGACTGCATC
ATCATCATGTTGTGGCAGGTATTTGCTATTTTTTTACAAACAGGACAGGATTCAAGGTGA
AGGATACAATACCAAAGATTTGCTCCATGAGCAGTTTTAATGGCAAAAGAACCTTGACTT
TTGCTGATTATACTACTTCAACTAAAACTGACCTTCACAATATGAAGATTTCATTCTCAC
AAATAAATGGCTGGACTGATGTCTTTTATTAGACTCACAAACAGTGATTAGCATAGATGC
TTTCAAGGCCACAATCTGTCTTTTAATTCAGCTACAGATAAGAGAACGGAAGTCATGGGA
GGCACTAAAAGCTTAAGTAATCTTTGTTTCTTAAGAACGCAGAACTATTTACTTAGGGAT
CACATTCTGCCACTTTCCAGCATTATCAACAGTTATCATATTTATCCTGTTAACAGGATG
GATTTTTTGTTTGTGTATAATAATTCGGGCCCCGGCTGCACTGATGTGTTTTATGGCATG
TGGTCAACGCCTATATATTGCTGGTCTATAACCGCTCCATAAACTGCAGATGCTATCATT
GAAATGAATGAGCCCAAGTATCTACTGAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved