Oryctolagus_cuniculus Locus Mono:96:SNORD86
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:96:SNORD86
Oryctolagus_cuniculus
Mono:96:SNORD86
scaffold_181365
SNORD86
1001..1085
2085
TTAACTTAAAAGGCTGACAGAGAGATCTTCCAACCCCTAGTTCATTCTAAACGTCTCCA
ATAGCTGAAGCTGGGCCAGGCCAAATCCAGGAGCTGGAGGCTCAATTCAGGTCTCCCACA
TAGGTGACAGGGACCCAAGCACTTGTCACCTGCTGCCTCTCATACATGCATCAGCTAGGA
GCTAGAATCAGGAATAGAGTCCGGGACTCAAGTCCAGGCGTTCTGACGTCAGATGACGGA
GAACTAAGCAGGGTCTTAACTGCTGTGCCAAATGTGCAACCCTCAGTCCCACCCCTTTTT
TGTTACTCAAATTGTTCCAGCTTTGGCCACTGGGAGCTCTTTCAGTTTGGCGGCTGTATC
CCTTGAAACGTCCCCATGCTCAAATATCAGCTGTGCATGATACTCACGCCGCAGGACTTC
TCCTTTTAAAGTGTGCAGTTCAGTGGTTTTCAGCATACCCACAGAGTTGTGTAACTTCAG
AACAGTCTCATCACTCCCCAAAAACCATATCCCCATCTCCCCCTCCCCTGTCAGCCCTGG
TTCATGTTCTGCCTCTCTGTGGCCTGTTCTGCACGTTTCATAGAAGTGGTTGAGGGAGAG
CGGCTTCTTCCTCTCTTAGCACCACGTGTGCAAGGTGCATCCGTGTTGCAGCAGGCATCA
GAACTCACTCCGGGGGTCTGCCCAGCCCCTGCTTTTTAGTCTCTTCGTGGTCATGGCAGT
TTCTCACTTCTGTCATTCTCTTTTTCCCCATTTATCTAAGCCAGTATCGATTCATGGGTT
CTTACTTTATTCAAGGGTTGTAACCAGTTCCCAGCATTTTGGTGTTTTTGTTGTGCCAGG
TTTGGCCAGGGGGAGCCCTTCCCAGCCTGCTCATTGCTAACAGCCTGCCATCCAGTGAGC
ATCCTTCCCTTACCACAACAGCAGGTGTTTTGAGCTCTTCTTGCCCTCACCCTGGAACCA
GCTATCTCCCCAGGGAGCAGGAGATAGCAGAAGCCAAGGCCTGTCATGGTGATGGCTGAC
CAGGGCTCCCTGGCTTTTACAGGCCTCTGCTGGGGCCGAACGGCCAGTGCTGGTGTCTGA
GCGATTCCCAGGGCTCAGATCTCCAGAGCCCTGAAGACAAGGGCAGTGCACCAAAACAGG
GACTCGTTTTCCACTCTGCCTTCATTGGCCAGGCAGCTGCTGCCAGGCACAAAGGCTGCA
TCTCCTGATACCCTGGCTGACAAATGCAGTGTTGCTTCATGAAGCGACTGCTTCTCTGGG
GTAGCCACGGGTATATCTGGGGAGGAGCTTCAAGGACAAGTTGAAGAGCAGCTGTCCTGT
GAGACTGGAGAGAGTCCACAGAAGACCCTGGGTGGCACGAAGGAAGCCATGGTTCAGGCA
GAGGCGCGGCTACTGAGGTCACCCACAGGCTGGAGAAACTGAAGCAGTGCTTGAAGGAGG
AAGAGAAGCACCCGCTCTGCTCGCCCCGGCGTCCTTGAGAAACAGCTGCAGTGTCCACAG
GACGCTGCGGGGACGCACAGAACCAGAGGGAAGAGACAAAGGCTCCAGGAGGCTCGGGAG
GACGGAATGGGAAAGCCAGGTTCCTTCCCCCAAAGCCAAGAGGAAGAAATGTTCTCCCGA
GGAGGAAGGTGAGCAGTGGTCGCGATGAGCCCAGGCCTCCCCCAGAGGAAGAAACTCGCA
GCTCAGGAGGGCTCAGCTGACGCCGAAGAAGCTCGAAGACGTGGGAGCAGGATGGTTCTC
AGGAAAAGAGGATGAAGAGGCTGCTGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved