Oryctolagus_cuniculus Locus Poly:26:SNORD26
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:26:SNORD26
Oryctolagus_cuniculus
Poly:26:SNORD26
scaffold_134645
SNORD26, SNORD27, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31
1001..1074, 1278..1353, 1650..1725, 2017..2141, 2350..2414, 2585..2653, 2816..2884
3353
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCCGCCGCGGGCTTTGTGAAGACAAACGGCGAGAGCGGGCCTCCTATGATGAGGACCTAT
TCACAGACCTGTACTGAGCCCCGTGAGGATGAGTCCCTCTGAGGAGACGGGGCCTGCAGC
GCCGATACCTCGTTCGGCCGCCGCGTCGGGGACAGCGTGCCCAGATGCGCGGCTCTAACT
CAGTCTCCCCTGCAGGACCTGGGCGCGTTTGAGCAAACGGAGGGAGCGCCGTTACTGAGC
GTGAGTGTTCTCCGGCCTTCTGAAACCTCTCTGATCAACTGCTACGGGGATGATTGCGAC
ACTTGAACTCTCTCTTGCTGAGGGGCTAGTGGAGAAAATGCAAATTCTGAGCAGCACTGT
TTGTAGCGGGTGGCTGGGGCCCCCCGCCCCGTTCTGGGTGTGACCGAATGGTCTCTCTTC
AGATGTTGCTCGGATCGGGGACCTGCCGGGTCGACGATGGAGGCTGCCCCTTCACCCTCT
GCAGCGCTGGCCGTACCGCGAGGCTCCAGGTGGGCGTCCTTGGCTTGTGTTACAGGGAGG
GACATTTTCTGGTTGGCCACTCCATGATGAACGAACGTAGAATGACAAGCATATGGCTGA
ACAAGGAAGTGATGCCACATTCCTACTGAGAAGTGGGCCGGGGGTATTCCAGGGTCTTTG
AATGACTGTTCTTGGCTAACATAAAGTACCTCTCATCCGCAGCGTCACATAACCAGCCCT
GGGGAGTTTGGACGCGTCCCAAGGTGAACAAAGGTAAGCCAGGAGCTTGAAGTATGTCGT
CTCCTGAATTGTTCTCCGCAATCAGGAGGGCAGGTGGTTGGTGTAGCGTTGTTTTGCTGC
TTCCACCTTGTTCCTCTTGACATGATTTTATGGGGAAGAAGAGTCCCCGCCAGTGGGGTG
CTCTTCCTTTACCCAGCATGCCACATTACTGTCAGATGATTAGAGCTGATAAAGCTGACG
CTTGGTGAAGTGTGACAGTTAATAGCATGTTAGAGTTCTGATGGCAGTTGTTGTTCATGA
AGAAATCTTGTCTCATCGTAGCATTTGGAAATAACTATTTGCTCCCCTTTGCCAGGTTCT
CGTGCTGACGGATTCTTCTGTCTGCTGGTAAGTTGCTTTACCTGGTAACATGTGAAGTCA
TTATCCGAAGGGAAAGTTTACCATCATGATGCTTGTACCAGAGACTTGCTGGAGATAGAC
GTAAAGCTGACTTATTTCTCAGTTGCCCACTGTTATCCAAGGTCAAATTCTTGAAATTGA
AAGTGATACTTAAACGTTGCAGTTTGCCAGGGTCTGGTGCCAATGAGGAACAGACATCCT
GTCTTACTCCCTGTTTTAATCCCAGAGCCAGTAATGGTGAACCCACTGGGGTGACTGGGA
GATGGGATGAGAACTGGTTCTGTAAGGAACTGTCTGAGGTGCAACAGATTCTTACAGATA
GCATTAACTGGGCTTTCCTGGTCATATAATCAGTCACATTAGGCTACCTTTAAGCCACTC
TGGATGTTGTGCCAATAATTTTTTTTTTTAATTACCAGCCTCCTCCTGTTCCTATGCTCC
ATTGAGAAATCTTCAGAGTGAAGAGGTTAGTTTACTTTTGTCCTGTGGTTTATGCTGGCA
AAGTAGGCAGTTTGTGGGATGAATCAAACTAGCTCACTATGAGTGACCATGAAAACACAT
GAACACCCGAGAAACTGGCTAAGACAGGACTGGGGGATCCCAGTGTATAAGGAACCTTTG
ACCCACACCCTTGTCTTGTCTTCAGGTGCTGTCACCATTGGCCTGCTTGTTGGTTCAAAG
GTGAGTAATTCCAACATGTGTTGTAAGTCCAGTATATTGGATGAGAAGAAATGCCTTTCT
GGACTATGTATGATGACTTACTGGAATCTCGTTCGGCTGATGGCTTGCTGTTGAGACTCG
GAAATCTGACTTCTAGGAATGGTGTCTTATGTGGGAACAAATGTGGAGTGTGAGCAACAG
TGACAGGCTCAATCTTATTTGTTTCAGGTCCAGCACCTTGGAAGCCCAGAGTGATTCCAG
GTAAATACCTCTTCTGTATTTTCCATTTGTGTCTGAACTGCCATAATCAGTCTGGGCTCA
CTAGTGATGAGTCTGATACCGCCCCAGTCTGATCACTGTGACTGAAAGGTATTTTCTGAC
CTGTGAGCTCATCTAACACTAAGTTGATTGGGTAGGCTTCGTAGCCTGTAGGAAGTATTT
AGTGCTGTCTGAATTGTGCTTTGAAACTGACATAGCCAGCTGGTGCCACTGCCACTCACT
AAGGCTAATCCTCCGCCTGCAGCGCTGGCACCACAGGTTCTAGTCCTGGTTGCTCCTCTT
CCAGGCCAGCTCTCTGCTGTGGCCTGCAAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGC
CCCTACACCCACATGGGAGACTCTGTCTCTTACTAACTCTGTCAAAAAAACTGGTGTAGC
CTTTACAGATGTGCATTTCTTCATCTCTTTCAGGGAAACGAAGGTGAATTCCAGGCTGAA
GCTCCTGGTAAGCAGCCTTAAATAAAGGTGGGCTATACTAGAATTTCCCAGTGAGGAAGC
ACTCACACGTCTTACTTCCTGTCCTAGCCCCAGAGCCTGTAAAGGTGAACCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved